MS4A2 (NM_001142303) Human Untagged Clone
CAT#: SC325586
MS4A2 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for, beta polypeptide) (MS4A2), transcript variant 2
"NM_001142303" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MS4A2 |
Synonyms | APY; ATOPY; FCER1B; FCERI; IGEL; IGER; IGHER; MS4A1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325586 representing NM_001142303.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACACAGAAAGTAATAGGAGAGCAAATCTTGCTCTCCCACAGGAGCCTTCCAGTGTGCCTGCATTT GAAGTCTTGGAAATATCTCCCCAGGAAGTATCTTCAGGCAGACTATTGAAGTCGGCCTCATCCCCACCA CTGCATACATGGCTGACAGTTTTGAAAAAAGAGCAGGAGTTCCTGGGGGTAACACAAATTCTGACTGCT ATGATATGCCTTTGTTTTGGAACAGTTGTCTGCTCTGTACTTGATATTTCACACATTGAGGGAGACATT TTTTCATCATTTAAAGCAGGTTATCCATTCTGGGGAGCCATATTTTTTTCTATTTCTGGAATGTTGTCA ATTATATCTGAAAGGAGAAATGCAACATATCTGGTGAGAGGAAGCCTGGGAGCAAACACTGCCAGCAGC ATAGCTGGGGGAACGGGAATTACCATCCTGATCATCAACCTGAAGAAGAGCTTGGCCTATATCCACATC CACAGTTGCCAGAAATTTTTTGAGACCAAGTGCTTTATGGCTTCCTTTTCCACTGTATGTATTTTTTTT TGTGTGGGAAGACTAAGATTCTGGGTCCTAATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142303 |
Insert Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142303.1 |
RefSeq Size | 1106 bp |
RefSeq ORF | 588 bp |
Locus ID | 2206 |
Cytogenetics | 11q12.1 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Asthma, Fc epsilon RI signaling pathway |
MW | 21.5 kDa |
Gene Summary | The allergic response involves the binding of allergen to receptor-bound IgE followed by cell activation and the release of mediators responsible for the manifestations of allergy. The IgE-receptor, a tetramer composed of an alpha, beta, and 2 disulfide-linked gamma chains, is found on the surface of mast cells and basophils. This gene encodes the beta subunit of the high affinity IgE receptor which is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member is localized to 11q12, among a cluster of membrane-spanning 4A gene family members. Alternative splicing results in multiple transcript variants encoding distinct proteins. Additional transcript variants have been described but require experimental validation. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. This variant encodes isoform 2, which has a shorter and distinct C-terminus that is predicted to lack a transmembrane region and have an incomplete CD20 domain, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227577 | MS4A2 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for, beta polypeptide) (MS4A2), transcript variant 2 |
USD 300.00 |
|
RC227577L3 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2), transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC227577L4 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2), transcript variant 2, mGFP tagged |
USD 600.00 |
|
RG227577 | MS4A2 (tGFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A2), transcript variant 2 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review