SAP30L (NM_001131062) Human Untagged Clone

CAT#: SC325513

SAP30L (untagged)-Human SAP30-like (SAP30L), transcript variant 2


  "NM_001131062" in other vectors (4)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SAP30L"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SAP30L
Synonyms NS4ATP2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001131062, the custom clone sequence may differ by one or more nucleotides
ATGAACGGCTTCAGCACGGAGGAGGACAGCCGCGAAGGGCCCCCCGCCGCCCCAGCTGCC
GCCGCCCCGGGCTACGGCCAGAGCTGCTGCCTCATCGAGGACGGCGAGCGCTGCGTCCGG
CCCGCGGGCAACGCCTCCTTCAGCAAGAGGGTCCAGAAGAGCATCTCGCAGAAGAAACTC
AAGCTGGACATCGACAAGAGCGTTGATCTGTTCCAGCTGCAGGTGAACACCCTACGACGT
TATAAACGACACTACAAGTTGCAGACCAGACCAGGCTTCAATAAGGCCCAGTTAGCAGAA
ACTGTGAGTCGACACTTCAGGAACATACCTGTGAATGAAAAAGAGACCCTTGCCTACTTC
ATCTACATGGTGAAGAGTAACAAGAGTAGACTGGACCAGAAATCGGAGGGTGGCAAGCAG
CTTGAG
Restriction Sites Please inquire     
ACCN NM_001131062
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001131062.1, NP_001124534.1
RefSeq Size 6120 bp
RefSeq ORF 429 bp
Locus ID 79685
UniProt ID Q9HAJ7
Cytogenetics 5q33.2
Gene Summary Isoform 1: Functions as transcription repressor, probably via its interaction with histone deacetylase complexes (PubMed:16820529, PubMed:18070604). Involved in the functional recruitment of the class 1 Sin3-histone deacetylase complex (HDAC) to the nucleolus (PubMed:16820529). Binds DNA, apparently without sequence-specificity, and bends bound double-stranded DNA (PubMed:19015240). Binds phosphoinositol phosphates (phosphoinositol 3-phosphate, phosphoinositol 4-phosphate and phosphoinositol 5-phosphate) via the same basic sequence motif that mediates DNA binding and nuclear import (PubMed:19015240, PubMed:26609676).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.