ADAMDEC1 (NM_001145272) Human Untagged Clone
CAT#: SC325037
ADAMDEC1 (untagged)-Human ADAM-like, decysin 1 (ADAMDEC1), transcript variant 3
"NM_001145272" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ADAMDEC1 |
Synonyms | M12.219 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145272, the custom clone sequence may differ by one or more nucleotides
ATGATCTTAAATGGAGAAGAAATCATTCTCTCCCTACAAAAAACCAAGCACCTCCTGGGG CCAGACTACACTGAAACATTGTACTCACCCAGAGGAGAGGAAATTACCACGAAACCTGAG AACATGGAACACTGTTACTATAAAGGAAACATCCTAAATGAAAAGAATTCTGTTGCCAGC ATCAGTACTTGTGACGGGTTGAGAGGATACTTCACACATCATCACCAAAGATACCAGATA AAACCTCTGAAAAGCACAGACGAGAAAGAACATGCCGTCTTTACATCTAACCAGGAGGAA CAAGACCCAGCTAACCACACATGTGGTGTGAAGAGCACTGACGGGAAACAAGGCCCAATT CGAATCTCTAGATCACTCAAAAGCCCAGAGAAAGAAGACTTTCTTCGGGCACAGAAATAC ATTGATCTCTATTTGGTGCTGGATAATGCCTTTTATAAGAACTATAATGAGAATCTAACT CTGATAAGAAGCTTTGTGTTTGATGTGATGAACCTACTCAATGTGATATATAACACCATA GATGTTCAAGTGGCCTTGGTAGGTATGGAAATCTGGTCTGATGGGGATAAGATAAAGGTG GTGCCCAGCGCAAGCACCACGTTTGACAACTTCCTGAGATGGCACAGTTCTAACCTGGGG AAAAAGATCCACGACCATGCTCAGCTTCTCAGCGGGATTAGCTTCAACAATCGACGTGTG GGACTGGCAGCTTCAAATTCCTTGTGTTCCCCATCTTCGGTTGCTGTTATTGAGGCTAAA AAAAAGAATAATGTGGCTCTTGTAGGAGTGATGTCACATGAGCTGGGCCATGTCCTTGGT ATGCCTGATGTTCCATTCAACACCAAGTGTCCCTCTGGCAGTTGTGTGATGAATCAGTAT CTGAGTTCAAAATTCCCAAAGGATTTCAGTACATCTTGCCGTGCACATTTTGAAAGATAC CTTTTATCTCAGAAACCAAAGTGCCTGCTGCAAGCACCTATTCCTACAAATATAATGACA ACACCAGTGTGTGGGAACCACCTTCTAGAAGTGGGAGAAGACTGTGATTGTGGCTCTCCT AAGGAGTGTACCAATCTCTGCTGTGAAGCCCTAACGTGTAAACTGAAGCCTGGAACTGAT TGCGGAGGAGATGCTCCAAACCATACCACAGAG |
Restriction Sites | Please inquire |
ACCN | NM_001145272 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145272.1, NP_001138744.1 |
RefSeq Size | 2229 bp |
RefSeq ORF | 1176 bp |
Locus ID | 27299 |
UniProt ID | O15204 |
Cytogenetics | 8p21.2 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) omits an alternate exon compared to variant 1. Translation may initiate at an internal AUG site (compared to variant 1) due to leaky scanning as both AUG sites are associated with a weak Kozak signal. It is possible that this transcript is not protein-coding as initiation from the AUG site in exon 1 would render the transcript a candidate for nonsense-mediated decay. The same protein isoform is predicted for transcript variants 2 and 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227739 | ADAMDEC1 (Myc-DDK-tagged)-Human ADAM-like, decysin 1 (ADAMDEC1), transcript variant 3 |
USD 503.00 |
|
RC227739L3 | Lenti-ORF clone of ADAMDEC1 (Myc-DDK-tagged)-Human ADAM-like, decysin 1 (ADAMDEC1), transcript variant 3 |
USD 803.00 |
|
RC227739L4 | Lenti-ORF clone of ADAMDEC1 (mGFP-tagged)-Human ADAM-like, decysin 1 (ADAMDEC1), transcript variant 3 |
USD 803.00 |
|
RG227739 | ADAMDEC1 (tGFP-tagged) - Human ADAM-like, decysin 1 (ADAMDEC1), transcript variant 3 |
USD 703.00 |
{0} Product Review(s)
Be the first one to submit a review