TBC1D7 (NM_001143966) Human Untagged Clone

CAT#: SC324868

TBC1D7 (untagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 4


  "NM_001143966" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-TBC1D7 Antibody - C-terminal region
    • 100 ul

USD 539.00

Other products for "TBC1D7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TBC1D7
Synonyms MGCPH; PIG51; TBC7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324868 representing NM_001143966.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTGAGGACTCTCAGAGAAACTTTCGTTCAGTATATTATGAGAAAGTGGGGTTTCGTGGAGTTGAA
GAAAAGAAATCATTAGAAATTCTCCTAAAAGATGACCGTCTGGGAATCTTGCCTCCACACCACGAGTCC
CATGCCAAGGTGATGATGTATCGTAAGGAGCAGTACTTGGATGTCCTTCATGCCCTGAAAGTCGTTCGC
TTTGTTAGTGATGCCACACCTCAGGCTGAAGTCTATCTCCGCATGTATCAGCTGGAGTCTGGGAAGTTA
CCTCGAAGTCCCTCTTTTCCACTGGAGCCAGATGATGAAGTGTTTCTTGCCATAGCTAAAGCCATGGAG
GAAATGGTGGAAGATAGTGTCGACTGTTACTGGATCACCCGACGCTTTGTGAACCAATTAAATACCAAG
TACCGGGATTCCTTGCCCCAGTTGCCAAAAGCGTTTGAACAATACTTGAATCTGGAAGATGGCAGACTG
CTGACTCATCTGAGGATGTGTTCCGCGGCGCCCAAACTTCCTTATGATCTCTGGTTCAAGAGGTGCTTT
GCGGGATGTTTGCCTGAATCCAGTTTACAGAGGGTTTGGGATAAAGTTGTGAGTGGATCCTGTAAGATC
CTAGTTTTTGTAGCTGTCGAAATTTTATTAACCTTTAAAATAAAAGTTATGGCACTGAACAGTGCAGAG
AAGATAACAAAGTTTCTGGAAAATATTCCCCAGGACAGCTCAGACGCGATCGTGAGCAAGGCCATTGAC
TTGTGGCACAAACACTGTGGGACCCCGGTCCATTCAAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001143966
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001143966.3
RefSeq Size 1099 bp
RefSeq ORF 801 bp
Locus ID 51256
UniProt ID Q9P0N9
Cytogenetics 6p24.1
MW 30.7 kDa
Gene Summary This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' UTR and lacks an in-frame exon in the 5' coding region compared to variant 1, which results in a shorter isoform (b) than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.