EIF5A (NM_001143761) Human Untagged Clone
CAT#: SC324740
EIF5A (untagged)-Human eukaryotic translation initiation factor 5A (EIF5A), transcript variant C
"NM_001143761" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EIF5A |
Synonyms | eIF-4D; EIF-5A; EIF5A1; eIF5AI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324740 representing NM_001143761.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGATGACTTGGACTTCGAGACAGGAGATGCAGGGGCCTCAGCCACCTTCCCAATGCAGTGCTCA GCATTACGTAAGAATGGCTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCG AAGACTGGCAAGCACGGCCACGCCAAGGTCCATCTGGTTGGTATTGACATCTTTACTGGGAAGAAATAT GAAGATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAAAGGAATGACTTCCAGCTGATT GGCATCCAGGATGGGTACCTATCACTGCTCCAGGACAGCGGGGAGGTACGAGAGGACCTTCGTCTCCCT GAGGGAGACCTTGGCAAGGAGATTGAGCAGAAGTACGACTGTGGAGAAGAGATCCTGATCACGGTGCTG TCTGCCATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001143761 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001143761.1 |
RefSeq Size | 1284 bp |
RefSeq ORF | 465 bp |
Locus ID | 1984 |
UniProt ID | P63241 |
Cytogenetics | 17p13.1 |
MW | 16.8 kDa |
Gene Summary | mRNA-binding protein involved in translation elongation. Has an important function at the level of mRNA turnover, probably acting downstream of decapping. Involved in actin dynamics and cell cycle progression, mRNA decay and probably in a pathway involved in stress response and maintenance of cell wall integrity. With syntenin SDCBP, functions as a regulator of p53/TP53 and p53/TP53-dependent apoptosis. Regulates also TNF-alpha-mediated apoptosis. Mediates effects of polyamines on neuronal process extension and survival. May play an important role in brain development and function, and in skeletal muscle stem cell differentiation. Also described as a cellular cofactor of human T-cell leukemia virus type I (HTLV-1) Rex protein and of human immunodeficiency virus type 1 (HIV-1) Rev protein, essential for mRNA export of retroviral transcripts.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (C) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon compared to variant A. The encoded isoform (B) has a shorter N-terminus compared to isoform A. Variants B, C, and D encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226600 | EIF5A (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 5A (EIF5A), transcript variant C |
USD 150.00 |
|
RC226600L3 | Lenti ORF clone of Human eukaryotic translation initiation factor 5A (EIF5A), transcript variant C, Myc-DDK-tagged |
USD 450.00 |
|
RC226600L4 | Lenti ORF clone of Human eukaryotic translation initiation factor 5A (EIF5A), transcript variant C, mGFP tagged |
USD 450.00 |
|
RG226600 | EIF5A (tGFP-tagged) - Human eukaryotic translation initiation factor 5A (EIF5A), transcript variant C |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review