ATF7 (NM_001130060) Human Untagged Clone

CAT#: SC323081

ATF7 (untagged)-Human activating transcription factor 7 (ATF7), transcript variant 3


  "NM_001130060" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


ATF7 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "ATF7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATF7
Synonyms ATFA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC323081 representing NM_001130060.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAGACGACAGACCGTTTGTGTGCAATGCCCCGGGCTGTGGACAGAGATTTACAAACGAGGACCAC
CTGGCAGTTCATAAACACAAGCATGAGATGACATTGAAATTTGGCCCAGCCCGAACTGACTCAGTCATC
ATTGCAGATCAAACGCCTACTCCAACTAGATTCCTGAAGAACTGTGAGGAGGTGGGACTCTTCAATGAA
CTAGCTAGCTCCTTTGAACATGAATTCAAGAAAGCTGCAGATGAGGATGAGAAAAAGGCTGCTGCTGGG
CCCCTTGACATGTCTCTGCCTTCCACACCAGACATCAAAATCAAAGAAGAAGAGCCAGTGGAGGAGGTT
ACCCCAAAGCCTGTTCTGATCTCTACCCCCACACCCACCATTGTACGTCCTGGCTCCCTGCCTCTCCAC
TTGGGCTATGATCCACTTCATCCAACCCTTCCCTCCCCAACCTCTGTCATCACACAGGCTCCACCATCC
AACAGGCAAATGGGGTCTCCCACTGGCTCCCTCCCTCTTGTCATGCATCTTGCTAATGGACAGACCATG
CCTGTGTTGCCAGGGCCTCCAGTACAGATGCCGTCTGTTATATCGCTGGCCAGACCTGTGTCCATGGTG
CCCAACATTCCTGGTATCCCTGGCCCACCAGTTAACAGTAGTGGCTCCATTTCTCCCTCTGGCCACCCT
ATACCATCAGAAGCCAAGATGAGACTGAAAGCCACCCTAACTCACCAAGTCTCCTCAATCAATGGTGGT
TGTGGAATGGTGGTGGGTACTGCCAGCACCATGGTGACAGCCCGCCCAGAGCAGAGCCAGATTCTCATC
CAGCACCCTGATGCCCCATCCCCTGCCCAGCCACAGGTCTCACCAGCTCAGCCCACCCCTAGTACTGGG
GGGCGACGGCGGCGCACAGTAGATGAAGATCCAGATGAGCGACGGCAGCGCTTTCTGGAGCGCAACCGG
GCTGCAGCCTCCCGCTGCCGCCAAAAGCGAAAGCTGTGGGTGTCCTCCCTAGAGAAGAAGGCCGAAGAA
CTCACTTCTCAGAACATTCAGCTGAGTAATGAAGTCACATTACTACGCAATGAGGTGGCCCAGTTGAAA
CAGCTACTGTTAGCTCATAAAGACTGCCCAGTCACTGCACTACAGAAAAAGACTCAAGGCTATTTAGAA
AGCCCCAAGGAAAGCTCAGAGCCAACGGGTTCTCCAGCCCCTGTGATTCAGCACAGCTCAGCAACAGCC
CCTAGCAATGGCCTCAGTGTTCGCTCTGCAGCTGAAGCTGTGGCCACCTCGGTCCTCACTCAGATGGCC
AGCCAAAGGACAGAACTGAGCATGCCGATACAATCGCATGTAATCATGACCCCACAGTCCCAGTCTGCG
GGCAGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130060
Insert Size 1389 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001130060.1
RefSeq Size 6641 bp
RefSeq ORF 1389 bp
Locus ID 11016
UniProt ID P17544
Cytogenetics 12q13.13
Protein Families Transcription Factors
MW 49.6 kDa
Gene Summary Plays important functions in early cell signaling. Binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AG][AG]-3'), a sequence present in many viral and cellular promoters. Activator of the NF-ELAM1/delta-A site of the E-selectin promoter. Has no intrinsic transcriptional activity, but activates transcription on formation of JUN or FOS heterodimers. Also can bind TRE promoter sequences when heterodimerized with members of the JUN family.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in an internal exon, compared to variant 2, resulting in a shorter isoform (3, also known as ATFa1 or ATF-a delta), compared to isoform 2. There are no publicly available transcripts representing this variant; it is supported by data in PMIDs 1694576 and 8939888, and by alternative splicing annotation on accessions X52943.1 and X57197.1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.