GAMT (NM_000156) Human Untagged Clone

CAT#: SC320844

GAMT (untagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1


  "NM_000156" in other vectors (7)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
GAMT Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "GAMT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GAMT
Synonyms CCDS2; HEL-S-20; PIG2; TP53I2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_000156.4 GCGGCGCGCGATCGAGGTCGGGTCGCCGTCCAGCCTGCAGCATGAGCGCCCCCAGCGCGA
CCCCCATCTTCGCGCCCGGCGAGAACTGCAGCCCCGCGTGGGGGGCGGCGCCCGCGGCCT
ACGACGCAGCGGACACGCACCTGCGCATCCTGGGCAAGCCGGTGATGGAGCGCTGGGAGA
CCCCCTATATGCACGCGCTGGCCGCCGCCGCCTCCTCCAAAGGGGGCCGGGTCCTGGAGG
TGGGCTTTGGCATGGCCATCGCAGCGTCAAAGGTGCAGGAGGCGCCCATTGATGAGCATT
GGATCATCGAGTGCAATGACGGCGTCTTCCAGCGGCTCCGGGACTGGGCCCCACGGCAGA
CACACAAGGTCATCCCCTTGAAAGGCCTGTGGGAGGATGTGGCACCCACCCTGCCTGACG
GTCACTTTGATGGGATCCTGTACGACACGTACCCACTCTCGGAGGAGACCTGGCACACAC
ACCAGTTCAACTTCATCAAGAACCACGCCTTTCGCCTGCTGAAGCCGGGGGGCGTCCTCA
CCTACTGCAACCTCACCTCCTGGGGGGAGCTGATGAAGTCCAAGTACTCAGACATCACCA
TCATGTTTGAGGAGACGCAGGTGCCCGCGCTGCTGGAGGCCGGCTTCCGGAGGGAGAACA
TCCGTACGGAGGTGATGGCGCTGGTCCCACCGGCCGACTGCCGCTACTACGCCTTCCCAC
AGATGATCACGCCCCTGGTGACCAAAGGCTGAGCCCCCACCCCGGCCCGGCCACACCCAT
GCCCTCCTCCGTGCCTTCCTGGCCGGGAGTCCAGGGTGTCGCACCAGCCCTGGGCTGATC
CCAGCTGTGTGTCACCAGAAGCTTTCCCGGCTTCTCTGTGAGGGGTCCCACCAGCCCAGG
GCTGATCCCAGCTGTGTGTCACCAGCAGCTTTCCCAGCTTCTCTGTGAGGGTCACTGCTG
CCCACTGCAGGGTCCCTGAGGTGAAGTAAACGCCGGCGCTGGGCTTGGCCAGTCGGCAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_000156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000156.4, NP_000147.1
RefSeq Size 1086 bp
RefSeq ORF 711 bp
Locus ID 2593
UniProt ID Q14353
Cytogenetics 19p13.3
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Glycine, serine and threonine metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (1) is the longer transcript but encodes the shorter isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.