ZNF237 (ZMYM5) (NM_001039649) Human Untagged Clone
CAT#: SC320830
ZMYM5 (untagged)-Human zinc finger, MYM-type 5 (ZMYM5), transcript variant 2
"NM_001039649" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZNF237 |
Synonyms | HSPC050; MYM; ZNF198L1; ZNF237 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001039649.1
GCTGAGAGTGGGGGTGGCTGGGAGCAGCGCAGCCTCCGGAGGAGGAGGCGGAGGCCGAGG
ACCAGGAATCACCTTCAAGCCTATGTCGTGAGGCTTTGGCAGAAATTAAGAAGGAAATAT CTCCATTATTCATTGGCATGGAAAAATGTTCAGTGGGAGGATTAGAGTTGACTGAACAGA CTCCTGCTTTATTAGGGAATATGGCCATGGCAACTAGTCTCATGGACATAGGGGATTCAT TTGGTCATCCAGCTTGTCCTTTAGTCAGTAGATCTAGGAACTCACCAGTGGAAGATGATG ATGATGATGATGATGTTGTGTTTATTGAATCTATACAACCTCCTTCAATTTCTGCTCCAG CAATAGCTGATCAAAGAAACTTCATATTTGCATCATCAAAAAATGAAAAGCCTCAAGGAA ATTATTCTGTAATTCCTCCTTCTTCAAGAGATTTGGCATCTCAGAAGGGAAATATAAGTG AGACAATTGTTATTGATGATGAAGAGGACGTAGAAACAAATGGAGGAGCAGAGAAAAAGT CTTCCTTTTTTATCGAATGGGGACTTCCTGGAACTAAAAACAAAACCAACGATTTGGATT TCTCCACTTCCAGTCTTTCAAGAAGTAAGACCAAGACTGGAGTAAGACCTTTTAACCCTG GTAGAATGAATGTGGCAGGAGACTTATTTCAGAATGGAGAATTTGCAACTCATCATAGTC CTGAGATGCATCTACAAAGAAGGCTAATGTCATTCTTCCAGTAGAATCAAGCAAATCCTT CCAAGAATTTTATAGTACATCTTGTTTGTCTCCCTGTGAAAACAACTGGAATCTTAAAAA AGGAGTTTTTAATAAGTCAAGATGTACAATTTGTAGTAAATTAGCAGAGGTCTGGATTTT TATACCTAAGTTGTTGTTTAGGCTAACAGTGATAATTTTAACTTTTAAGTGCTATTATGT ACTCTTTCATCTACATAATGCACATGTTCTGGATGTATAACATGAAGCTGAAAGGAAGAA TAAGGATATGTTAGAACTATCTTATGGGATATTTTATAAATAAAATTCCATTTGCATAGC ATGGAAAGTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001039649 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039649.1, NP_001034738.1 |
RefSeq Size | 1246 bp |
RefSeq ORF | 627 bp |
Locus ID | 9205 |
UniProt ID | Q9UJ78 |
Cytogenetics | 13q12.11 |
Gene Summary | Functions as a transcriptional regulator.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 3' UTR and has multiple differences in the 3' coding region, compared to variant 3. These differences result in a protein (isoform 2) with a shorter and distinct C-terminus, compared to isoform 3. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this RefSeq transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202780 | ZMYM5 (Myc-DDK-tagged)-Human zinc finger, MYM-type 5 (ZMYM5), transcript variant 2 |
USD 300.00 |
|
RC202780L3 | Lenti ORF clone of Human zinc finger, MYM-type 5 (ZMYM5), transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC202780L4 | Lenti ORF clone of Human zinc finger, MYM-type 5 (ZMYM5), transcript variant 2, mGFP tagged |
USD 600.00 |
|
RG202780 | ZMYM5 (tGFP-tagged) - Human zinc finger, MYM-type 5 (ZMYM5), transcript variant 2 |
USD 500.00 |
|
SC310750 | ZMYM5 (untagged)-Human zinc finger, MYM-type 5 (ZMYM5), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review