ZNF237 (ZMYM5) (NM_001039649) Human Untagged Clone

CAT#: SC320830

ZMYM5 (untagged)-Human zinc finger, MYM-type 5 (ZMYM5), transcript variant 2


  "NM_001039649" in other vectors (5)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
ZNF237 Antibody - N-terminal region
    • 100 ul

USD 485.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ZNF237"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF237
Synonyms HSPC050; MYM; ZNF198L1; ZNF237
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001039649.1 GCTGAGAGTGGGGGTGGCTGGGAGCAGCGCAGCCTCCGGAGGAGGAGGCGGAGGCCGAGG
ACCAGGAATCACCTTCAAGCCTATGTCGTGAGGCTTTGGCAGAAATTAAGAAGGAAATAT
CTCCATTATTCATTGGCATGGAAAAATGTTCAGTGGGAGGATTAGAGTTGACTGAACAGA
CTCCTGCTTTATTAGGGAATATGGCCATGGCAACTAGTCTCATGGACATAGGGGATTCAT
TTGGTCATCCAGCTTGTCCTTTAGTCAGTAGATCTAGGAACTCACCAGTGGAAGATGATG
ATGATGATGATGATGTTGTGTTTATTGAATCTATACAACCTCCTTCAATTTCTGCTCCAG
CAATAGCTGATCAAAGAAACTTCATATTTGCATCATCAAAAAATGAAAAGCCTCAAGGAA
ATTATTCTGTAATTCCTCCTTCTTCAAGAGATTTGGCATCTCAGAAGGGAAATATAAGTG
AGACAATTGTTATTGATGATGAAGAGGACGTAGAAACAAATGGAGGAGCAGAGAAAAAGT
CTTCCTTTTTTATCGAATGGGGACTTCCTGGAACTAAAAACAAAACCAACGATTTGGATT
TCTCCACTTCCAGTCTTTCAAGAAGTAAGACCAAGACTGGAGTAAGACCTTTTAACCCTG
GTAGAATGAATGTGGCAGGAGACTTATTTCAGAATGGAGAATTTGCAACTCATCATAGTC
CTGAGATGCATCTACAAAGAAGGCTAATGTCATTCTTCCAGTAGAATCAAGCAAATCCTT
CCAAGAATTTTATAGTACATCTTGTTTGTCTCCCTGTGAAAACAACTGGAATCTTAAAAA
AGGAGTTTTTAATAAGTCAAGATGTACAATTTGTAGTAAATTAGCAGAGGTCTGGATTTT
TATACCTAAGTTGTTGTTTAGGCTAACAGTGATAATTTTAACTTTTAAGTGCTATTATGT
ACTCTTTCATCTACATAATGCACATGTTCTGGATGTATAACATGAAGCTGAAAGGAAGAA
TAAGGATATGTTAGAACTATCTTATGGGATATTTTATAAATAAAATTCCATTTGCATAGC
ATGGAAAGTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001039649
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039649.1, NP_001034738.1
RefSeq Size 1246 bp
RefSeq ORF 627 bp
Locus ID 9205
UniProt ID Q9UJ78
Cytogenetics 13q12.11
Gene Summary Functions as a transcriptional regulator.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR and has multiple differences in the 3' coding region, compared to variant 3. These differences result in a protein (isoform 2) with a shorter and distinct C-terminus, compared to isoform 3. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this RefSeq transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.