EBPL (NM_032565) Human Untagged Clone

CAT#: SC320109

EBPL (untagged)-Human emopamil binding protein-like (EBPL)


  "NM_032565" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
EBPL Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "EBPL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EBPL
Synonyms EBRP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_032565.1 CTCTCCCTGCTTTCCTCTGCCGCATGGTCCTGGGCCGTTGGCGTCGGAAGCCTGAAGCAT
GGGCGCTGAGTGGGAGCTGGGGGCCGAGGCTGGCGGTTCGCTGCTGCTGTGCGCGGCGCT
GCTGGCGGCGGGCTGCGCCCTGGGCCTGCACCTGGGCCGCGGGCAGGGGGCGGCGGACCG
CGGGGCGCTCATCTGGCTCTGCTACGACGCGCTGGTGCACTTCGCGCTGGAAGGCCCTTT
TGTCTACTTGTCTTTAGTAGGAAACGTTGCAAATTCCGATGGCTTGATTGCTTCTTTATG
GAAAGAATATGGCAAAGCTGATGCAAGATGGGTTTATTTTGATCCAACCATTGTGTCTGT
GGAAATTCTGACCGTCGCCCTGGATGGGTCTCTGGCATTGTTCCTCATTTATGCCATAGT
CAAAGAAAAATATTACCGGCATTTCCTGCAGATCACCCTGTGCGTGTGCGAGCTGTATGG
CTGCTGGATGACCTTCCTCCCAGAGTGGCTCACCAGAAGCCCCAACCTCAACACCAGCAA
CTGGCTGTACTGTTGGCTTTACCTGTTTTTTTTTAACGGTGTGTGGGTTCTGATCCCAGG
ACTGCTACTGTGGCAGTCATGGCTAGAACTCAAGAAAATGCATCAGAAAGAAACCAGTTC
AGTGAAGAAGTTTCAGTGAACTTTCAAAACGATAAACACCAGTATCTAACTTCATGAACC
AGAATGAATCAAATCTTTTTGTTTGGCGAAAATGTAATACATTCCAGTCTACACTTTGTT
TTTGTATTGTTGCTCCTGAACAACCTGTTTCAAATTGGTTTTAAGGCGACCAGTTTTCGT
TGTATTGTTGTTCAATTAAATGGTGATATAGGGAAAAGAGAACAAATTTGAATTTGTAAT
AATAAAATGTTTAATTATAAAAAAAAAAAAGAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_032565
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032565.1, NP_115954.1
RefSeq Size 931 bp
RefSeq ORF 621 bp
Locus ID 84650
UniProt ID Q9BY08
Cytogenetics 13q14.2
Protein Families Transmembrane
Gene Summary Does not possess sterol isomerase activity and does not bind sigma ligands.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.