AKAP14 (NM_178813) Human Untagged Clone
CAT#: SC320098
AKAP14 (untagged)-Human A kinase (PRKA) anchor protein 14 (AKAP14), transcript variant 1
"NM_178813" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AKAP14 |
Synonyms | AKAP28; PRKA14 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_178813.5
GTTGTGAGGAGTAAATGACTTCAGACACTGAAGGCTTAACACAGTGACTGGCATATCATA
GGGATGCCCAATACATACCAGCTGTGAGGCTTATCACCACTGTTCTTCCTGGCATGGCCC TGTAAGCTCATCTTCGGCTGAAGAGAAGCTAGCACTTGCAAACATTCCATCTGGCAATCT GAGAGAAGCTACTGAGAGAATCCTGAGACATCCCCAGCCACCTACCACTGCTCCTGTTCC AAGCAAAGAAGATCTGCTCACTCCGGAAAAAGAAAATGAGTGAGACTCAAAATTCAACAA GCCAGAAAGCAATGGATGAGGATAACAAAGCCGCAAGCCAAACAATGCCGAATACACAAG ACAAGAACTACGAGGATGAATTGACTCAAGTAGCTCTAGCTCTGGTTGAGGATGTCATCA ATTATGCTGTTAAGATTGTGGAAGAGGAGCGAAACCCTTTGAAAAACATCAAGTGGATGA CTCACGGTGAATTCACTGTGGAAAAGGGTCTTAAACAAATTGACGAATATTTTTCGAAGT GTGTTTCTAAAAAATGCTGGGCACATGGCGTAGAGTTTGTAGAGAGGAAAGACTTAATTC ACAGCTTCCTCTACATCTACTATGTACACTGGAGTATCTCAACTGCTGACCTACCCGTAG CACGAATCTCTGCTGGTACCTACTTCACCATGAAGGTCTCCAAAACCAAACCACCGGATG CACCCATTGTTGTTTCTTATGTAGGTGACCACCAAGCATTAGTTCACAGACCAGGAATGG TTCGCTTTCGAGAAAACTGGCAGAAGAATCTTACTGATGCCAAATATAGTTTCATGGAGT CATTCCCCTTCTTATTCAATCGTGTCTGATACTTACAGGATGTCTTAGGATTGTTTTTCT CATCAGGATACATTAAAAATACAATACAGCACGTCAAACCACAGAATATTTATTGAGTAA TAAACTTGTGGCACACAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_178813 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_178813.5, NP_848928.1 |
RefSeq Size | 855 bp |
RefSeq ORF | 594 bp |
Locus ID | 158798 |
UniProt ID | Q86UN6 |
Cytogenetics | Xq24 |
Protein Families | Druggable Genome |
Gene Summary | The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The protein anchors PKA in ciliary axonemes and, in this way, may play a role in regulating ciliary beat frequency. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209895 | AKAP14 (Myc-DDK-tagged)-Human A kinase (PRKA) anchor protein 14 (AKAP14), transcript variant 1 |
USD 300.00 |
|
RC209895L3 | Lenti ORF clone of Human A kinase (PRKA) anchor protein 14 (AKAP14), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC209895L4 | Lenti ORF clone of Human A kinase (PRKA) anchor protein 14 (AKAP14), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RG209895 | AKAP14 (tGFP-tagged) - Human A kinase (PRKA) anchor protein 14 (AKAP14), transcript variant 1 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review