MAST4 (NM_198828) Human Untagged Clone

CAT#: SC319866

MAST4 (untagged)-Human microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 2


  "NM_198828" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal anti-MAST4 antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MAST4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAST4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_198828.1 GCAGCGCGGGAGCACAGTGGAGCGCAGATCGCGGACCCGAGCGGGCATGTCCCCGCGCGC
GGGAGCCTCCGTTTGCGGCCGGGCCCGGGCGGCTGTGAACTTAGCAGCGGGCTCCTGCGG
CCCCGTCACTGCCATGTAGTCGCTGGCGGGGCTCCCTGCAGCCCGGGAGCGGCAGTGCCA
GTGAGCCTGAGCCCAGGAGCCCGCGTCTTCCCCGGGAGGCGCTGAGTGCGCGCCGCGCCC
CCGCCGCTCGGGAGGCACTTTGGGCCAGACAGGGAAATGGGGGAGAAAGTTTCGGAGGCG
CCAGAGCCGGTGCCCCGCGGCTGCAGTGGCCACGGCAGCCGGACTCCAGCCTCTGCGCTG
GTCGCCGCGTCCTCTCCGGGTGCTTCCTCGGCCGAGTCCTCCTCGGGCTCAGAAACTCTG
TCGGAGGAAGGGGAGCCCGGCGGCTTCTCCAGAGAGCATCAGCCGCCGCCGCCGCCGCCG
TTGGGAGGCACCCTGGGCGCCCGGGCGCCCGCCGCGTGGGCTCCGGCAAGCGTGCTGCTG
GAGCGCGGAGTCCTTGCGCTGCCGCCGCCGCTTCCCGGAGGAGCTGTGCCGCCCGCGCCC
CGGGGCAGCAGCGCGTCCCAGGAGGAGCAGGACGAGGAGCTTGACCACATATTATCCCCT
CCACCCATGCCGTTTCGGAAATGCAGCAACCCAGATGTGGCTTCTGGCCCTGGAAAATCA
CTGAAGTATAAAAGACAGCTGAGTGAGGATGGAAGACAGCTAAGGCGAGGGAGCCTGGGA
GGAGCCCTGACTGGGAGGTACCTTCTTCCAAACCCGGTGGCGGGACAGGCCTGGCCGGCC
TCTGCAGAGACGTCCAACCTCGTGCGCATGCGCAGCCAGGCCCTGGGCCAGTCGGCGCCC
TCGCTCACCGCCAGCCTGAAGGAGCTGAGTCTCCCCAGAAGAGGAAGTTTGATAGATTCC
CAGAAGTGGAATTGCTTGGTCAAACGCCCTGTGTGTCCAAATGCTGGGAGAACATCACCC
CTTGGATGAATTGCCACCACATTAAATAAAACATATCCAAAGCTCAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_198828
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_198828.1, NP_942123.1
RefSeq Size 1105 bp
RefSeq ORF 753 bp
Locus ID 375449
UniProt ID O15021
Cytogenetics 5q12.3
Protein Families Druggable Genome, Protein Kinase
Gene Summary This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (2) uses a distinct 3' coding region and 3' UTR, compared to variant 3. The resulting isoform (b) has a substantially shorter and distinct C-terminus, compared to isoform c.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.