MRPL4 (NM_146387) Human Untagged Clone
CAT#: SC319301
MRPL4 (untagged)-Human mitochondrial ribosomal protein L4 (MRPL4), nuclear gene encoding mitochondrial protein, transcript variant 2
"NM_146387" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRPL4 |
Synonyms | CGI-28; L4mt |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_146387.1
GACCTCCCGCGGCGTGGGAGGCTGCGCGGCGATGCTGCAGTTCGTCCGGGCCGGGGCGCG
GGCCTGGCTTCGGCCTACCGGCAGCCAGGGCCTGAGTTCCCTGGCGGAAGAGGCAGCGCG TGCGACCGAGAACCCGGAGCAGGTGGCGAGCGAGGGTCTCCCGGAGCCCGTGCTGCGCAA AGTCGAGCTCCCGGTACCCACTCATCGACGCCCAGTGCAGGCCTGGGTCGAGTCCTTGCG GGGCTTCGAGCAGGAGCGCGTGGGCCTGGCCGACCTGCACCCCGATGTTTTCGCCACCGC GCCCAGGCTGGACATACTGCACCAGGTTGCTATGTGGCAGAAGAACTTCAAGAGAATTAG CTATGCCAAGACCAAGACGAGAGCCGAGGTGCGGGGCGGTGGCCGGAAGCCTTGGCCGCA GAAAGGCACTGGGCGGGCCCGGCATGGCAGCATCCGCTCTCCGCTCTGGCGAGGAGGAGG TGTTGCCCATGGCCCCCGGGGCCCCACAAGTTACTACTACATGCTGCCCATGAAGGTGCG GGCGCTGGGTCTCAAAGTGGCACTGACCGTCAAGCTGGCCCAGGACGACCTGCACATCAT GGACTCCCTAGAGCTGCCCACCGGAGACCCACAGTACCTGACAGAGCTGGCGCACTACCG CCGCTGGGGGGACTCCGTACTCCTCGTGGACTTAACACACGAGGAGATGCCACAGAGCAT CGTGGAGGCCACCTCTAGGCTTAAGACCTTCAACTTGATCCCGGCTGTTGGCCTAAATGT GCACAGCATGCTCAAGCACCAGACGCTGGTCCTGACGCTGCCCACCGTCGCCTTCCTGGA GGACAAGCTGCTCTGGCAGGACTCACGTTACAGACCCCTCTACCCCTTCAGCCTGCCCTA CAGCGACTTCCCCCGACCCCTACCCCACGCTACCCAGGGCCCAGCGGCCACCCCGTACCA CTGTTGATGTGAAGCACCTCTTCTGAGCCAGGCCGAGCCCCTGGCCGACTTGGGAGCCTC AGGCCCACGCCCACCCTTCGAGGAAGGTGTCACCTGGACCCCTTCATTCCACGGAGGAAG CTGAGGCCACAGGGAGCGGCCATCGCCATTGGGAAGGGGCGACTCCACGGAAAGCCCAGA CGGGCTTCTGCATCCATTCCCTCTTTTTGTTTTTAAAATAAATTGTATTTTTGAATCAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_146387 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_146387.1, NP_666499.1 |
RefSeq Size | 1375 bp |
RefSeq ORF | 936 bp |
Locus ID | 51073 |
UniProt ID | Q9BYD3 |
Cytogenetics | 19p13.2 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified alternatively spliced variants that encode different protein isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203621 | MRPL4 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L4 (MRPL4), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 300.00 |
|
RC203621L3 | Lenti ORF clone of Human mitochondrial ribosomal protein L4 (MRPL4), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 600.00 |
|
RC203621L4 | Lenti ORF clone of Human mitochondrial ribosomal protein L4 (MRPL4), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 600.00 |
|
RG203621 | MRPL4 (tGFP-tagged) - Human mitochondrial ribosomal protein L4 (MRPL4), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review