DUSP12 (NM_007240) Human Untagged Clone

CAT#: SC319165

DUSP12 (untagged)-Human dual specificity phosphatase 12 (DUSP12)


  "NM_007240" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Anti-DUSP12 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00

Other products for "DUSP12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DUSP12
Synonyms DUSP1; YVH1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_007240.1 GGCACGAGGCCGCCTTGTCTCTGGGCGCGGCCATGTTGGAGGCTCCGGGCCCGAGTGATG
GCTGCGAGCTCAGCAACCCCAGCGCCAGCAGAGTCAGCTGTGCCGGGCAGATGCTGGAAG
TGCAGCCAGGATTGTATTTCGGTGGGGCCGCGGCCGTCGCGGAGCCAGATCACCTGAGGG
AAGCGGGCATCACGGCCGTGCTAACAGTGGACTCGGAGGAGCCCAGCTTCAAGGCGGGGC
CTGGGGTCGAGGATCTATGGCGCCTCTTCGTGCCAGCGCTGGACAAACCCGAGACGGACC
TACTCAGCCATCTGGACCGGTGCGTGGCCTTCATCGGTCAGGCCCGCGCTGAGGGCCGTG
CGGTGTTGGTGCACTGTCATGCAGGAGTCAGTCGAAGTGTGGCCATAATAACTGCTTTTC
TCATGAAGACTGACCAACTTCCCTTTGAAAAAGCCTATGAAAAGCTCCAGATTCTCAAAC
CAGAGGCTAAGATGAATGAGGGGTTTGAGTGGCAACTGAAATTATACCAGGCAATGGGAT
ATGAAGTGGATACCTCTAGTGCAATTTATAAGCAATATCGTTTACAAAAGGTTACAGAGA
AGTATCCAGAATTGCAGAATTTACCTCAAGAACTCTTTGCTGTTGACCCAACTACCGTTT
CACAAGGATTGAAAGATGAGGTTCTCTACAAGTGTAGAAAGTGCAGGCGATCATTATTTC
GAAGTTCTAGTATTCTGGATCACCGTGAAGGAAGTGGACCTATAGCCTTTGCCCACAAGA
GAATGACACCATCTTCCATGCTTACCACAGGGAGGCAAGCTCAATGTACATCTTATTTCA
TTGAACCTGTACAGTGGATGGAATCTGCTTTGTTGGGAGTGATGGATGGACAGCTTCTTT
GCCCAAAATGCAGTGCCAAGTTGGGTTCCTTCAACTGGTATGGTGAACAGTGCTCTTGTG
GTAGGTGGATAACACCTGCTTTTCAAATACATAAGAATAGAGTGGATGAAATGAAAATAT
TGCCTGTTTTGGGATCACAAACAGGAAAAATATGAACATGATATTTTATAGCTTGGGAAG
AAACTTGCAGATGATATGTGCTGCCTTTGCTTCTTATCATTCATGGCAGATTGTTTGTGC
TTTCAACATTTCATTTGAAATGGGAGAAGATAAAATCACTTGATGTAACCTGGAAACTAT
GCTTTACATGGCAATCAAAGCCTTTTGATCATGTACATTTTATTTGATATTAAAATCTTT
TATAACCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_007240
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007240.1, NP_009171.1
RefSeq Size 1271 bp
RefSeq ORF 1023 bp
Locus ID 11266
UniProt ID Q9UNI6
Cytogenetics 1q23.3
Domains DSPc
Protein Families Druggable Genome, Phosphatase
Gene Summary The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product is the human ortholog of the Saccharomyces cerevisiae YVH1 protein tyrosine phosphatase. It is localized predominantly in the nucleus, and is novel in that it contains, and is regulated by a zinc finger domain. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.