DSCR1L1 (RCAN2) (NM_005822) Human Untagged Clone
CAT#: SC317291
RCAN2 (untagged)-Human regulator of calcineurin 2 (RCAN2)
"NM_005822" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DSCR1L1 |
Synonyms | CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317291 representing NM_005822.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCAGCCCCTAGCATGGACTGTGATGTTTCCACTCTGGTTGCCTGTGTGGTGGATGTCGAGGTCTTT ACCAATCAGGAGGTTAAGGAAAAATTTGAGGGACTGTTTCGGACTTATGATGACTGTGTGACGTTCCAG CTATTTAAGAGTTTCAGACGTGTCCGTATAAACTTCAGCAATCCTAAATCTGCAGCCCGAGCTAGGATA GAGCTTCATGAAACCCAATTCAGAGGGAAAAAATTAAAGCTCTACTTTGCACAGGTTCAGACTCCAGAG ACAGATGGAGACAAACTGCACTTGGCTCCACCCCAGCCTGCCAAACAGTTTCTCATCTCGCCCCCTTCC TCCCCACCTGTTGGCTGGCAGCCCATCAACGATGCCACGCCAGTCCTCAACTATGACCTCCTCTATGCT GTGGCCAAACTAGGACCAGGAGAGAAGTATGAGCTCCATGCAGGGACTGAGTCCACCCCAAGTGTCGTC GTGCACGTGTGCGACAGTGACATAGAGGAAGAAGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATC CAAACTCGGCGTCCTGGCCTGCCACCCTCCGTGTCCAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_005822 |
Insert Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005822.3 |
RefSeq Size | 3438 bp |
RefSeq ORF | 594 bp |
Locus ID | 10231 |
UniProt ID | Q14206 |
Cytogenetics | 6p12.3 |
Domains | Calcipressin |
MW | 22 kDa |
Gene Summary | This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1, also known as alpha) represents the longest transcript and encodes the shorter isoform (1, also known as alpha). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207202 | RCAN2 (Myc-DDK-tagged)-Human regulator of calcineurin 2 (RCAN2) |
USD 457.00 |
|
RC207202L3 | Lenti ORF clone of Human regulator of calcineurin 2 (RCAN2), Myc-DDK-tagged |
USD 757.00 |
|
RC207202L4 | Lenti ORF clone of Human regulator of calcineurin 2 (RCAN2), mGFP tagged |
USD 757.00 |
|
RG207202 | RCAN2 (tGFP-tagged) - Human regulator of calcineurin 2 (RCAN2) |
USD 657.00 |
|
SC116477 | RCAN2 (untagged)-Human regulator of calcineurin 2 (RCAN2) |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review