DSCR1L1 (RCAN2) (NM_005822) Human Untagged Clone

CAT#: SC317291

RCAN2 (untagged)-Human regulator of calcineurin 2 (RCAN2)


  "NM_005822" in other vectors (5)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-RCAN2 Antibody
    • 100 ul

USD 380.00

Other products for "DSCR1L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DSCR1L1
Synonyms CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317291 representing NM_005822.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCAGCCCCTAGCATGGACTGTGATGTTTCCACTCTGGTTGCCTGTGTGGTGGATGTCGAGGTCTTT
ACCAATCAGGAGGTTAAGGAAAAATTTGAGGGACTGTTTCGGACTTATGATGACTGTGTGACGTTCCAG
CTATTTAAGAGTTTCAGACGTGTCCGTATAAACTTCAGCAATCCTAAATCTGCAGCCCGAGCTAGGATA
GAGCTTCATGAAACCCAATTCAGAGGGAAAAAATTAAAGCTCTACTTTGCACAGGTTCAGACTCCAGAG
ACAGATGGAGACAAACTGCACTTGGCTCCACCCCAGCCTGCCAAACAGTTTCTCATCTCGCCCCCTTCC
TCCCCACCTGTTGGCTGGCAGCCCATCAACGATGCCACGCCAGTCCTCAACTATGACCTCCTCTATGCT
GTGGCCAAACTAGGACCAGGAGAGAAGTATGAGCTCCATGCAGGGACTGAGTCCACCCCAAGTGTCGTC
GTGCACGTGTGCGACAGTGACATAGAGGAAGAAGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATC
CAAACTCGGCGTCCTGGCCTGCCACCCTCCGTGTCCAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_005822
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005822.3
RefSeq Size 3438 bp
RefSeq ORF 594 bp
Locus ID 10231
UniProt ID Q14206
Cytogenetics 6p12.3
Domains Calcipressin
MW 22 kDa
Gene Summary This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1, also known as alpha) represents the longest transcript and encodes the shorter isoform (1, also known as alpha).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.