PPAPDC1B (PLPP5) (NM_001102560) Human Untagged Clone

CAT#: SC316902

PPAPDC1B (untagged)-Human phosphatidic acid phosphatase type 2 domain containing 1B (PPAPDC1B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPAPDC1B
• Synonyms: DPPL1; HTPAP; PPAPDC1B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC316902 representing NM_001102560.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGGAAGGCGGCGGCGGCGGTGGCCTTTGGGGCCGAAGTGGGCGTGCGGCTCGCGCTGTTCGCGGCC
  TTCCTGGTGACGGAGCTGCTCCCCCCGTTCCAGAGACTCATCCAGCCGGAGGAGATGTGGCTCTACCGG
  AACCCCTACGTGGAGGCGGAGTATTTCCCCACCAAGCCGATGTTTGTTATTGCATTTCTCTCTCCACTG
  TCTCTGATCTTCCTGGCCAAATTTCTCAAGAAGGCAGACACAAGAGACAGCAGACAAGCCTGCCTGGCT
  GCCAGCCTTGCCCTGGCTCTGAATGGCGTCTTTACCAACACAATAAAACTGATCGTAGGGAGGCCACGC
  CCAGATTTCTTCTACCGCTGCTTCCCTGATGGGCTAGCCCATTCTGACTTGATGTGTACAGGGGATAAG
  GACGTGGTGAATGAGGGCCGAAAGAGCTTCCCCAGTGGACATTCTTCCTGTATGAATATCATATGGACT
  CTACCCTATGCTTGTTTTCACATCATTGAATTTAACCTAGAAAGCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001102560
• Insert Size: 531 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001102560.1
• RefSeq Size: 776 bp
• RefSeq ORF: 531 bp
• Locus ID: 84513
• UniProt ID: Q8NEB5
• Cytogenetics: 8p11.23
• Protein Families: Transmembrane
• MW: 19.7 kDa
• Gene Summary: Displays magnesium-independent phosphatidate phosphatase activity in vitro. Catalyzes the conversion of phosphatidic acid to diacylglycerol. May be a metastatic suppressor for hepatocellular carcinoma.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region and lacks multiple exons, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.