Carbonic anhydrase X (CA10) (NM_001082533) Human Untagged Clone

CAT#: SC315994

CA10 (untagged)-Human carbonic anhydrase X (CA10), transcript variant 1


  "NM_001082533" in other vectors (6)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-CA10 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Carbonic anhydrase X"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Carbonic anhydrase X
Synonyms CA-RPX; CARPX; HUCEP-15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315994 representing NM_001082533.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAATAGTCTGGGAGGTGCTTTTTCTTCTTCAAGCCAATTTCATCGTCTGCATATCAGCTCAACAG
AATTCACCAAAAATCCATGAAGGCTGGTGGGCATACAAGGAGGTGGTCCAGGGAAGCTTTGTTCCAGTT
CCTTCTTTCTGGGGATTGGTGAACTCAGCTTGGAATCTTTGCTCTGTGGGGAAACGGCAGTCGCCAGTC
AACATAGAGACCAGTCACATGATCTTCGACCCCTTTCTGACACCTCTTCGCATCAACACGGGGGGCAGG
AAGGTCAGTGGGACCATGTACAACACTGGAAGACACGTATCCCTTCGCCTGGACAAGGAGCACTTGGTC
AACATATCTGGAGGGCCCATGACATACAGCCACCGGCTGGAGGAGATCCGACTACACTTTGGGAGTGAG
GACAGCCAAGGGTCGGAGCACCTCCTCAATGGACAGGCCTTCTCTGGGGAGGTGCAGCTCATCCACTAT
AACCATGAGCTATATACGAATGTCACAGAAGCTGCAAAGAGTCCAAATGGATTGGTGGTAGTTTCTATA
TTTATAAAAGTTTCTGATTCATCAAACCCATTTCTTAATCGAATGCTCAACAGAGATACTATCACAAGA
ATAACATATAAAAATGATGCATATTTACTACAGGGGCTTAATATAGAGGAACTATATCCAGAGACCTCT
AGTTTCATCACTTACGATGGGTCGATGACTATCCCACCCTGCTATGAGACAGCAAGTTGGATCATAATG
AACAAACCTGTCTATATAACCAGGATGCAGATGCATTCCTTGCGCCTGCTCAGCCAGAACCAGCCATCT
CAGATCTTTCTGAGCATGAGTGACAACTTCAGGCCTGTCCAGCCACTCAACAACCGCTGCATCCGCACC
AATATCAACTTCAGTTTACAGGGGAAGGACTGTCCAAACAACCGAGCCCAGAAGCTTCAGTATAGAGTA
AATGAATGGCTCCTCAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001082533
Insert Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001082533.1
RefSeq Size 3386 bp
RefSeq ORF 987 bp
Locus ID 56934
UniProt ID Q9NS85
Cytogenetics 17q21.33-q22
Protein Families Druggable Genome
MW 37.6 kDa
Gene Summary This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.