Keratin 80 (KRT80) (NM_001081492) Human Untagged Clone

CAT#: SC315949

KRT80 (untagged)-Human keratin 80 (KRT80), transcript variant 2


  "NM_001081492" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-KRT80 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Keratin 80"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Keratin 80
Synonyms KB20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315949 representing NM_001081492.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTGCCGCTCCTGCGTGGTTGGCTTCAGCAGCCTCAGCAGCTGTGAGGTGACCCCGGTGGGCAGC
CCCCGGCCTGGAACCTCAGGATGGGACAGCTGCAGGGCCCCCGGGCCGGGCTTCAGCTCCCGCAGCCTC
ACAGGCTGCTGGTCGGCTGGCACTATCTCCAAGGTGACTGTGAACCCCGGCCTGCTGGTGCCCCTGGAT
GTCAAGTTGGACCCCGCTGTTCAGCAGCTGAAGAACCAGGAGAAGGAGGAGATGAAGGCCCTCAATGAT
AAATTTGCCTCCCTAATTGGCAAGGTGCAAGCCCTGGAACAGCGCAACCAGCTGCTGGAGACACGCTGG
AGCTTCCTGCAGGGCCAGGACTCAGCCATCTTCGACCTCGGGCATCTCTATGAGGAATATCAGGGCCGG
CTGCAGGAGGAACTGCGCAAAGTGAGCCAGGAGCGGGGGCAGCTGGAGGCCAACCTGCTGCAGGTGCTG
GAGAAGGTTGAGGAGTTTCGAATCAGGTATGAGGATGAGATCTCCAAGCGCACAGACATGGAGTTCACC
TTTGTTCAGCTGAAGAAGGACCTGGATGCAGAGTGTCTTCATCGGACTGAACTGGAAACCAAGTTAAAA
AGCCTGGAGAGCTTCGTGGAGTTGATGAAAACCATCTATGAGCAGGAGCTGAAGGACCTGGCAGCACAG
GTGAAGGATGTGTCGGTGACCGTCGGCATGGACAGCCGCTGCCACATCGACCTGAGCGGCATCGTGGAG
GAGGTGAAGGCCCAGTATGACGCCGTCGCGGCTCGCAGCCTGGAGGAGGCCGAGGCATACTCTCGGAGC
CAGCTGGAGGAGCAGGCCGCCCGCTCGGCCGAGTATGGGAGCAGCCTCCAGAGCAGCCGCAGCGAGATC
GCGGATCTCAATGTGCGCATCCAGAAGCTGCGGTCCCAGATCCTCTCTGTCAAGAGCCATTGCCTGAAA
CTGGAGGAGAACATCAAGACAGCTGAGGAGCAGGGTGAGCTGGCCTTCCAGGATGCCAAGACCAAGCTG
GCCCAGCTGGAGGCCGCCCTGCAGCAGGCCAAGCAGGACATGGCGCGGCAGCTGCGCAAGTACCAGGAG
CTGATGAACGTCAAGCTGGCCCTGGACATCGAGATCGCCACCTACAGGAAGCTGGTGGAGGGCGAGGAG
GGCAGGATGGACTCGCCCTCAGCCACTGTGGTCAGCGCTGTGCAGTCCAGGTGCAAAACCGCCCCTTCC
CTCCCCTACCCCTTATGTTCCCTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001081492
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001081492.1
RefSeq Size 3894 bp
RefSeq ORF 1269 bp
Locus ID 144501
UniProt ID Q6KB66
Cytogenetics 12q13.13
MW 47.2 kDa
Gene Summary Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene's expression profile shows that it encodes a type II epithelial keratin, although structurally the encoded protein is more like a type II hair keratin. This protein is involved in cell differentiation, localizing near desmosomal plaques in earlier stages of differentiation but then dispersing throughout the cytoplasm in terminally differentiating cells. The type II keratins are clustered in a region of chromosome 12q13. Two transcript variants encoding two different fully functional isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (K80.1, also known as b) has a distinct C-terminus and is shorter than isoform K80.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.