PDE7A (NM_002604) Human Untagged Clone

CAT#: SC313399

PDE7A (untagged)-Human phosphodiesterase 7A (PDE7A), transcript variant 2


  "NM_002604" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-PDE7A Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PDE7A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDE7A
Synonyms HCP1; PDE7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002604 edited
TGGTACCTCAATGGAAGTGTGTTACCAGCTGCCGGTACTGCCCCTGGACAGGCCGGTCCC
CCAGCACGTCCTCAGCCGCCGAGGAGCCATCAGCTTCAGCTCCAGCTCCGCTCTCTTCGG
CTGCCCCAATCCCCGGCAGCTCTCTCAGAGGCGTGGAGCTATTTCCTATGACAGTTCTGA
TCAGACTGCATTATACATTCGTATGCTAGGAGATGTACGTGTAAGGAGCCGAGCAGGATT
TGAATCAGAAAGAAGAGGTTCTCACCCATATATTGATTTTCGTATTTTCCACTCTCAATC
TGAAATTGAAGTGTCTGTCTCTGCAAGGAATATCAGAAGGCTACTAAGTTTCCAGCGATA
TCTTAGATCTTCACGCTTTTTTCGTGGTACTGCGGTTTCAAATTCCCTAAACATTTTAGA
TGATGATTATAATGGACAAGCCAAGTGTATGCTGGAAAAAGTTGGAAATTGGAATTTTGA
TATCTTTCTATTTGATAGACTAACAAATGGAAATAGTCTAGTAAGCTTAACCTTTCATTT
ATTTAGTCTTCATGGATTAATTGAGTACTTCCATTTAGATATGATGAAACTTCGTAGATT
TTTAGTTATGATTCAAGAAGATTACCACAGTCAAAATCCTTACCATAACGCAGTCCACGC
TGCGGATGTTACTCAGGCCATGCACTGTTACTTAAAGGAACCTAAGCTTGCCAATTCTGT
AACTCCTTGGGATATCTTGCTGAGCTTAATTGCAGCTGCCACTCATGATCTGGATCATCC
AGGTGTTAATCAACCTTTCCTTATTAAAACTAACCATTACTTGGCAACTTTATACAAGAA
TACCTCAGTACTGGAAAATCACCACTGGAGATCTGCAGTGGGCTTATTGAGAGAATCAGG
CTTATTCTCACATCTGCCATTAGAAAGCAGGCAACAAATGGAGACACAGATAGGTGCTCT
GATACTAGCCACAGACATCAGTCGCCAGAATGAGTATCTGTCTTTGTTTAGGTCCCATTT
GGATAGAGGTGATTTATGCCTAGAAGACACCAGACACAGACATTTGGTTTTACAGATGGC
TTTGAAATGTGCTGATATTTGTAACCCATGTCGGACGTGGGAATTAAGCAAGCAGTGGAG
TGAAAAAGTAACGGAGGAATTCTTCCATCAAGGAGATATAGAAAAAAAATATCATTTGGG
TGTGAGTCCACTTTGCGATCGTCACACTGAATCTATTGCCAACATCCAGATTGGTAACTA
TACATATTTAGATATAGCTGGTTAG
Restriction Sites Please inquire     
ACCN NM_002604
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002604.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002604.1, NP_002595.1
RefSeq Size 2990 bp
RefSeq ORF 1275 bp
Locus ID 5150
Cytogenetics 8q13.1
Domains PDEase, HDc
Protein Families Druggable Genome
Protein Pathways Progesterone-mediated oocyte maturation, Purine metabolism
Gene Summary The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2, also called PDE7A3) differs in the 5' and 3' UTRs and in the 5' and 3' coding sequences compared to variant 1. The resulting isoform (b) has distinct N- and C-termini compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.