Tapasin (TAPBP) (NM_172208) Human Untagged Clone

CAT#: SC312855

TAPBP (untagged)-Human TAP binding protein (tapasin) (TAPBP), transcript variant 2


  "NM_172208" in other vectors (4)

Reconstitution Protocol

USD 517.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TAPBP Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tapasin"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Tapasin
Synonyms NGS17; TAPA; TPN; TPSN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312855 representing NM_172208.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGTCCCTGTCTCTGCTCCTCGCTGTGGCTTTGGGCCTGGCGACCGCCGTCTCAGCAGGACCCGCG
GTGATCGAGTGTTGGTTCGTGGAGGATGCGAGCGGAAAGGGCCTGGCCAAGAGACCCGGTGCACTGCTG
TTGCGCCAGGGACCGGGGGAACCGCCGCCCCGGCCGGACCTCGACCCTGAGCTCTATCTCAGTGTACAC
GACCCCGCGGGCGCCCTCCAGGCTGCCTTCAGGCGGTATCCCCGGGGCGCCCCCGCACCACACTGCGAG
ATGAGCCGCTTCGTGCCTCTCCCCGCCTCTGCGAAATGGGCCAGCGGCCTGACCCCCGCGCAGAACTGC
CCGCGGGCCCTGGATGGGGCTTGGCTGATGGTCAGCATATCCAGCCCAGTCCTCAGCCTCTCCAGCCTC
TTGCGACCACAGCCAGAGCCTCAGCAGGAGCCTGTTCTCATCACCATGGCAACAGTGGTACTGACTGTC
CTCACCCACACCCCTGCCCCTCGAGTGAGACTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCCTAC
ATGCCCCCCACCTCCGAGGCCGCCTCATCTCTGGCTCCGGGTCCCCCTCCCTTTGGGCTAGAGTGGCGA
CGCCAGCACCTGGGTAAGGGACATCTGCTCCTGGCTGCAACTCCTGGGCTGAATGGCCAGATGCCAGCA
GCCCAAGAAGGGGCCGTGGCATTTGCTGCTTGGGATGATGATGAGCCATGGGGCCCATGGACCGGAAAT
GGGACCTTCTGGCTGCCTACAGTTCAACCCTTTCAGGAGGGCACCTATCTGGCCACCATACACCTGCCA
TACCTGCAAGGACAGGTCACCCTGGAGCTTGCTGTGTACAAACCCCCCAAAGTGTCCCTGATGCCAGCA
ACCCTTGCACGGGCCGCCCCAGGGGAGGCACCCCCGGAATTGCTCTGCCTTGTGTCCCACTTCTACCCT
TCTGGGGGCCTGGAGGTGGAGTGGGAACTCCGGGGTGGCCCAGGGGGCCGCTCTCAGAAGGCCGAGGGG
CAGAGGTGGCTCTCGGCCCTGCGCCACCATTCCGATGGCTCTGTCAGCCTCTCTGGGCACTTGCAGCCG
CCCCCAGTCACCACTGAGCAGCATGGGGCACGCTATGCCTGTCGAATTCACCATCCCAGCCTGCCTGCC
TCGGGGCGCAGCGCTGAGGTCACCCTGGAGGTAGCAGGTCTTTCAGGGCCCTCCCTTGAGGACAGCGTA
GGCCTTTTCCTGTCTGCCTTTCTTCTGCTTGGGCTCTTCAAGGCACTGGGCTGGGCTGCTGTCTACCTG
TCCACCTGCAAGGATTCAAAGAAGGTACAGTGCTCCACCTCTCTGTATCTTTCCCTTGTCACTTTATCT
CCTCATCCTATCTCAAAACCCATGGAGGGAGGCTGCTGGTGTGGTAGGCAGAACCTAGGCTTGGAATTC
ACACTGATCTGGGTTAAAACCTGGCACTATATCCTAACTGTAGGACTCTTTGAGCATGCTACTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_172208
Insert Size 1515 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172208.2
RefSeq Size 2003 bp
RefSeq ORF 1515 bp
Locus ID 6892
UniProt ID O15533
Cytogenetics 6p21.32
Protein Families Druggable Genome, Transmembrane
Protein Pathways Antigen processing and presentation
MW 53.9 kDa
Gene Summary This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.