APRIL (TNFSF13) (NM_172087) Human Untagged Clone
CAT#: SC312571
TNFSF13 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta
"NM_172087" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | APRIL |
Synonyms | APRIL; CD256; TALL-2; TALL2; TNLG7B; TRDL-1; UNQ383/PRO715; ZTNF2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_172087 edited
ATGCCAGCCTCATCTCCTTTCTTGCTAGCCCCCAAAGGGCCTCCAGGCAACATGGGGGGC CCAGTCAGAGAGCCGGCACTCTCAGTTGCCCTCTGGTTGAGTTGGGGGGCAGCTCTGGGG GCCGTGGCTTGTGCCATGGCTCTGCTGACCCAACAAACAGAGCTGCAGAGCCTCAGGAGA GAGGTGAGCCGGCTGCAGAGGACAGGAGGCCCCTCCCAGAATGGGGAAGGGTATCCCTGG CAGAGTCTCCCGGAGCAGAGTTCCGATGCCCTGGAAGCCTGGGAGAGTGGGGAGAGATCC CGGAAAAGGAGAGCAGTGCTCACCCAAAAACAGAAGAATGACTCCGATGTGACAGAGGTG ATGTGGCAACCAGCTCTTAGGCGTGGGAGAGGCCTACAGGCCCAAGGATATGGTGTCCGA ATCCAGGATGCTGGAGTTTATCTGCTGTATAGCCAGGTCCTGTTTCAAGACGTGACTTTC ACCATGGGTCAGGTGGTGTCTCGAGAAGGCCAAGGAAGGCAGGAGACTCTATTCCGATGT ATAAGAAGTATGCCCTCCCACCCGGACCGGGCCTACAACAGCTGCTATAGCGCAGGTGTC TTCCATTTACACCAAGGGGATATTCTGAGTGTCATAATTCCCCGGGCAAGGGCGAAACTT AACCTCTCTCCACATGGAACCTTCCTGGGGTTTGTGAAACTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_172087 |
Insert Size | 1840 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found two SNPs within the protein associated with this reference, NM_172087.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172087.1, NP_742084.1 |
RefSeq Size | 2228 bp |
RefSeq ORF | 705 bp |
Locus ID | 8741 |
UniProt ID | O75888 |
Cytogenetics | 17p13.1 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Gene Summary | The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (beta) lacks an alternate in-frame exon in the central coding region, compared to variant alpha, resulting in an isoform (beta) that is shorter than isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220974 | TNFSF13 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 330.00 |
|
RC220974L3 | Lenti-ORF clone of TNFSF13 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 630.00 |
|
RC220974L4 | Lenti-ORF clone of TNFSF13 (mGFP-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 630.00 |
|
RG220974 | TNFSF13 (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13), transcript variant beta |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review