MRPL43 (AK095556) Human Untagged Clone
CAT#: SC312489
(untagged)-Human cDNA FLJ38237 fis, clone FCBBF2005637
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "MRPL43"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRPL43 |
Synonyms | bMRP36a; L43mt; MRP-L43 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK095556, the custom clone sequence may differ by one or more nucleotides
ATGACGGCGCGCGGGACTCCGAGCCGCTTCTTGGCCAGCGTTCTCCACAACGGACTGGGT CGCTATGTGCAGCAGCTGCAGCGTCTGAGCTTCAGCGTCAGCCGCGACGGCGCCTCGTCT CGCGGCGCCAGGGAGTTCGTGGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGG GTCGTAATATATGTAAACTCGCGTCCGTGCTGCGTGCCCAGAGTAGTGGCCGAATACCTT AACGGGGCTGTGCGCGAGGAGAGCATCCACTGCAAGTCGGTCGAGGAGATCTCGACGCTG GTGCAGAAGCTGGCCGACCAGTCGGGCTTGGACGTGATCCGCATCCGCAAGCCCTTCCAC ACCGACAACCCTAGCATCCAGGGCCAGTGGCACCCCTTCACCAACAAGCCGACCACGTTC CGCGGGCTACGCCCCCGAGAGGTTCAGGATCCTGCCCCAGCCCAGGACACTGGCCTGAGA CTGTCTGCAGTTGCACCGCAGATCCTCCTGCCCGGCTGGCCCGACCCACCAGACCTCCCC ACAGTGGATCCTATCTCATCCTCATTGACCTCTGCTCCAGCCCCTATGCTGTCCGCAGTT TCTTGCCTCCCGATTGTCCCTGCACTGACCACTGTGTGCTCAGCG |
Restriction Sites | Please inquire |
ACCN | AK095556 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK095556.1, BAC04572.1 |
RefSeq Size | 2136 bp |
RefSeq ORF | 2136 bp |
Locus ID | 84545 |
Cytogenetics | 10q24.31 |
Domains | L51_S25_CI-B8 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. This gene and the gene for a semaphorin class 4 protein (SEMA4G) overlap at map location 10q24.31 and are transcribed in opposite directions. Sequence analysis identified multiple transcript variants encoding at least four different protein isoforms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.