PTPN20A (NM_001042391) Human Untagged Clone
CAT#: SC311249
PTPN20A (untagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 4
"NM_001042391" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTPN20A |
Synonyms | bA142I17.1; CT126; hPTPN20; PTPN20B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311249 representing NM_001042391.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATTGTAAACGATTATGAGGGAAATGACTCTGAAGCAGAAGACTTGAATTTCAGGGAGACTTTGCCT TCATCAAGTCAGGAAAACACACCTAGATCAAAGGTTTTTGAAAATAAAGTTAATTCAGAGAAGGTAAAA CTTTCTCTTCGGAATTTCCCACATAATGATTATGAGGATGTTTTTGAAGAGCCTTCAGAAAGTGGCAGT GATCCCAGCATGTGGACAGCCAGAGGCCCCTTCAGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCT GCAGGGCCATCACAGGCTCTCTCCCCTCTACTTTCTGATACGCGCAAAATTGTTTCTGAAGGAGAACTA GATCAGTTGGCTCAGATTCGGCCATTAATATTCAATTTTCATGAGCAGACAGCCATCAAGGATTGTTTG AAAATCCTTGAGGAAAAAACAGCAGCGTATGATATCATGCAGGAATTTATGACGGGAACTAGTCACTCT GTAAAACAGTTGCAGTTCACCAAGTGGCCAGACCATGGCACTCCTGCCTCAGCAGATAGCTTCATAAAA TATATTCGTTATGCAAGGAAGAGCCACCTTACAGGACCCATGGTTGTTCACTGCAGTGCCGGCATAGGC CGGACAGGGGTGTTCCTATGTGTGGATGTCGTGTTCTGTGCCATCGTAAAGAACTGTTCATTCAACATC ATGGATATAGTGGCCCAAATGAGAGAACAACGTTCTGGCATGGTTCAAACGAAGGAGCAGTATCACTTT TGTTACGATATTGTGCTTGAAGTTCTTCGGAAACTTCTGACTTTGGATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042391 |
Insert Size | 810 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042391.1 |
RefSeq Size | 2444 bp |
RefSeq ORF | 810 bp |
Locus ID | 653129 |
Cytogenetics | 10q11.22 |
Protein Families | Druggable Genome |
MW | 30.6 kDa |
Gene Summary | The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes and several are mutated in human diseases. Chromosome 10q contains a segmental duplication resulting in multiple copies of the protein tyrosine phosphatase, non-receptor type 20 gene. The two nearly identical copies are designated as PTPN20A and PTPN20B. A third copy is only partially duplicated and contains a pseudogene, designated as PTPN20C. This gene encodes the more centromeric copy, PTPN20A. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR and in the 5' coding region, compared to variant 1. It also lacks an in-frame segment of the coding region, compared to variant 1. The resulting protein (isoform 4) is shorter and contains a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216109 | PTPN20A (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 4 |
USD 300.00 |
|
RC216109L3 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 4, Myc-DDK-tagged |
USD 600.00 |
|
RC216109L4 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 4, mGFP tagged |
USD 600.00 |
|
RG216109 | PTPN20A (tGFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 4 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review