5HT4 Receptor (HTR4) (NM_001040169) Human Untagged Clone
CAT#: SC311000
HTR4 (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant a
"NM_001040169" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | 5HT4 Receptor |
Synonyms | 5-HT4; 5-HT4R |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001040169 edited
ATGGACAAACTTGATGCTAATGTGAGTTCTGAGGAGGGTTTCGGGTCAGTGGAGAAGGTG GTGCTGCTCACGTTTCTCTCGACGGTTATCCTGATGGCCATCTTGGGGAACCTGCTGGTG ATGGTGGCTGTGTGCTGGGACAGGCAGCTCAGGAAAATAAAAACAAATTATTTCATTGTA TCTCTTGCTTTTGCGGATCTGCTGGTTTCGGTGCTGGTGATGCCCTTTGGTGCCATTGAG CTGGTTCAAGACATCTGGATTTATGGGGAGGTGTTTTGTCTTGTTCGGACATCTCTGGAC GTCCTGCTCACAACGGCATCGATTTTTCACCTGTGCTGCATTTCTCTGGATAGGTATTAC GCCATCTGCTGCCAGCCTTTGGTCTATAGGAACAAGATGACCCCTCTGCGCATCGCATTA ATGCTGGGAGGCTGCTGGGTCATCCCCACGTTTATTTCTTTTCTCCCTATAATGCAAGGC TGGAATAACATTGGCATAATTGATTTGATAGAAAAGAGGAAGTTCAACCAGAACTCTAAC TCTACGTACTGTGTCTTCATGGTCAACAAGCCCTACGCCATCACCTGCTCTGTGGTGGCC TTCTACATCCCATTTCTCCTCATGGTGCTGGCCTATTACCGCATCTATGTCACAGCTAAG GAGCATGCCCATCAGATCCAGATGTTACAACGGGCAGGAGCCTCCTCCGAGAGCAGGCCT CAGTCGGCAGACCAGCATAGCACTCATCGCATGAGGACAGAGACCAAAGCAGCCAAGACC CTGTGCATCATCATGGGTTGCTTCTGCCTCTGCTGGGCACCATTCTTTGTCACCAATATT GTGGATCCTTTCATAGACTACACTGTCCCTGGGCAGGTGTGGACTGCTTTCCTCTGGCTC GGCTATATCAATTCCGGGTTGAACCCTTTTCTCTACGCCTTCTTGAATAAGTCTTTTAGA CGTGCCTTCCTCATCATCCTCTGCTGTGATGATGAGCGCTACCGAAGACCTTCCATTCTG GGCCAGACTGTCCCTTGTTCAACCACAACCATTAATGGATCCACACATGTACTAAGGTAC ACCGTTCTGCACAGGGGACATCATCAGGAACTCGAGAAACTGCCCATACACAATGACCCA GAATCCCTGGAATCATGCTTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001040169 |
Insert Size | 2000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040169.1, NP_001035259.1 |
RefSeq Size | 1481 bp |
RefSeq ORF | 1164 bp |
Locus ID | 3360 |
UniProt ID | Q13639 |
Cytogenetics | 5q32 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010] Transcript Variant: This variant (a) differs in the 5' UTR, 3' coding region and 3' UTR, compared to variant b. The resulting isoform (a) has a distinct C-terminus and is shorter than isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211606 | HTR4 (Myc-DDK-tagged)-Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant a |
USD 457.00 |
|
RC211606L3 | Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant a, Myc-DDK-tagged |
USD 757.00 |
|
RC211606L4 | Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant a, mGFP tagged |
USD 757.00 |
|
RG211606 | HTR4 (tGFP-tagged) - Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant a |
USD 657.00 |
{0} Product Review(s)
Be the first one to submit a review