CD46 (NM_002389) Human Untagged Clone

CAT#: SC310446

CD46 (untagged)-Human CD46 molecule, complement regulatory protein (CD46), transcript variant a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD46
• Synonyms: AHUS2; MCP; MIC10; TLX; TRA2.10
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_002389 edited
  ATGGAGCCTCCCGGCCGCCGCGAGTGTCCCTTTCCTTCCTGGCGCTTTCCTGGGTTGCTT
  CTGGCGGCCATGGTGTTGCTGCTGTACTCCTTCTCCGATGCCTGTGAGGAGCCACCAACA
  TTTGAAGCTATGGAGCTCATTGGTAAACCAAAACCCTACTATGAGATTGGTGAACGAGTA
  GATTATAAGTGTAAAAAAGGATACTTCTATATACCTCCTCTTGCCACCCATACTATTTGT
  GATCGGAATCATACATGGCTACCTGTCTCAGATGACGCCTGTTATAGAGAAACATGTCCA
  TATATACGGGATCCTTTAAATGGCCAAGCAGTCCCTGCAAATGGGACTTACGAGTTTGGT
  TATCAGATGCACTTTATTTGTAATGAGGGTTATTACTTAATTGGTGAAGAAATTCTATAT
  TGTGAACTTAAAGGATCAGTAGCAATTTGGAGCGGTAAGCCCCCAATATGTGAAAAGGTT
  TTGTGTACACCACCTCCAAAAATAAAAAATGGAAAACACACCTTTAGTGAAGTAGAAGTA
  TTTGAGTATCTTGATGCAGTAACTTATAGTTGTGATCCTGCACCTGGACCAGATCCATTT
  TCACTTATTGGAGAGAGCACGATTTATTGTGGTGACAATTCAGTGTGGAGTCGTGCTGCT
  CCAGAGTGTAAAGTGGTCAAATGTCGATTTCCAGTAGTCGAAAATGGAAAACAGATATCA
  GGATTTGGAAAAAAATTTTACTACAAAGCAACAGTTATGTTTGAATGCGATAAGGGTTTT
  TACCTCGATGGCAGCGACACAATTGTCTGTGACAGTAACAGTACTTGGGATCCCCCAGTT
  CCAAAGTGTCTTAAAGTGCTGCCTCCATCTAGTACAAAACCTCCAGCTTTGAGTCATTCA
  GTGTCGACTTCTTCCACTACAAAATCTCCAGCGTCCAGTGCCTCAGGTCCTAGGCCTACT
  TACAAGCCTCCAGTCTCAAATTATCCAGGATATCCTAAACCTGAGGAAGGAATACTTGAC
  AGTTTGGATGTTTGGGTCATTGCTGTGATTGTTATTGCCATAGTTGTTGGAGTTGCAGTA
  ATTTGTGTTGTCCCGTACAGATATCTTCAAAGGAGGAAGAAGAAAGGCACATACCTAACT
  GATGAGACCCACAGAGAAGTAAAATTTACTTCTCTCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_002389
• Insert Size: 3300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: ORF was fully sequenced and matches with that of NM_002389.3 .
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002389.3, NP_002380.3
• RefSeq Size: 3371 bp
• RefSeq ORF: 1179 bp
• Locus ID: 4179
• UniProt ID: P15529
• Cytogenetics: 1q32.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Complement and coagulation cascades
• Gene Summary: The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (a) represents the longest transcript and encodes isoform 1.