PTGER3 (NM_198719) Human Untagged Clone

CAT#: SC309549

PTGER3 (untagged)-Human prostaglandin E receptor 3 (subtype EP3) (PTGER3), transcript variant 9


  "NM_198719" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-PTGER3 Antibody (Cytoplasmic Domain)
    • 50 ug

USD 515.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PTGER3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTGER3
Synonyms EP3; EP3-I; EP3-II; EP3-III; EP3-IV; EP3-VI; EP3e; lnc003875; PGE2-R
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_198719, the custom clone sequence may differ by one or more nucleotides
ATGAAGGAGACCCGGGGCTACGGAGGGGATGCCCCCTTCTGCACCCGCCTCAACCACTCC
TACACAGGCATGTGGGCGCCCGAGCGTTCCGCCGAGGCGCGGGGCAACCTCACGCGCCCT
CCAGGGTCTGGCGAGGATTGCGGATCGGTGTCCGTGGCCTTCCCGATCACCATGCTGCTC
ACTGGTTTCGTGGGCAACGCACTGGCCATGCTGCTCGTGTCGCGCAGCTACCGGCGCCGG
GAGAGCAAGCGCAAGAAGTCCTTCCTGCTGTGCATCGGCTGGCTGGCGCTCACCGACCTG
GTCGGGCAGCTTCTCACCACCCCGGTCGTCATCGTCGTGTACCTGTCCAAGCAGCGTTGG
GAGCACATCGACCCGTCGGGGCGGCTCTGCACCTTTTTCGGGCTGACCATGACTGTTTTC
GGGCTCTCCTCGTTGTTCATCGCCAGCGCCATGGCCGTCGAGCGGGCGCTGGCCATCAGG
GCGCCGCACTGGTATGCGAGCCACATGAAGACGCGTGCCACCCGCGCTGTGCTGCTCGGC
GTGTGGCTGGCCGTGCTCGCCTTCGCCCTGCTGCCGGTGCTGGGCGTGGGCCAGTACACC
GTCCAGTGGCCCGGGACGTGGTGCTTCATCAGCACCGGGCGAGGGGGCAACGGGACTAGC
TCTTCGCATAACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTG
GCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGC
CGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACG
GCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATA
ATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAG
AAGCAGAAAGAATGCAACTTCTTCTTAATAGCTGTTCGCCTGGCTTCACTGAACCAGATC
TTGGATCCTTGGGTTTACCTGCTGTTAAGAAAGATCCTTCTTCGAAAGTTTTGCCAGATC
AGGTACCACACAAACAACTATGCATCCAGCTCCACCTCCTTACCCTGCCAGTGTTCCTCA
ACCTTGATGTGGAGCGACCATTTGGAAAGATAA
Restriction Sites Please inquire     
ACCN NM_198719
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198719.1, NP_942012.1
RefSeq Size 2353 bp
RefSeq ORF 1173 bp
Locus ID 5733
UniProt ID P43115
Cytogenetics 1p31.1
Protein Families Druggable Genome, GPCR, Transcription Factors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Transcript Variant: This variant (9) has multiple differences compared to variant 1. The resulting protein (isoform 4) has a distinct and shorter C-terminus, as compared to isoform 1. Transcript variants 4, 9 and 11 encode the same protein. Other names for variant 9 are EP3A, EP3-I, EP3a2, and EP3 subtype 1a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.