TEX19 (NM_207459) Human Untagged Clone

CAT#: SC308558

TEX19 (untagged)-Human testis expressed 19 (TEX19)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TEX19
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC308558 representing NM_207459.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTGCCCTCCGGTCAGCATGCGGTATGAGGAAGAGGGCATGTCCTACCTCTACGCCTCCTGGATGTAT
  CAGCTTCAACATGGAGATCAGCTAAGCATTTGCTTCACCTGCTTCAAGGCTGCCTTTCTAGACTTTAAA
  GACTTGCTGGAGTCAGAGGACTGGGAAGAAGACAACTGGGACCCTGAGCTGATGGAGCACACTGAGGCA
  GAGTCAGAGCAGGAGGGGTCCTCAGGGATGGAGCTGAGCTGGGGGCAGAGCCCAGGACAGCCTGTGCAG
  GGGGGCTCTGAGGCATGGGGGCCAGGGACCCTGGCAGCAGCCCCAGAAGGGTTGGAAGATGCAGGTCTG
  GACCCCCACTTTGTCCCCACTGAACTATGGCCTCAGGAGGCTGTGCCCCTGGGCCTGGGCCTTGAGGAT
  GCTGACTGGACCCAGGGTCTTCCCTGGAGATTTGAGGAGCTTCTTACCTGCTCACACTGGCCAAGCTTC
  TTTCCTTCATAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_207459
• Insert Size: 495 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_207459.3
• RefSeq Size: 1951 bp
• RefSeq ORF: 495 bp
• Locus ID: 400629
• UniProt ID: Q8NA77
• Cytogenetics: 17q25.3
• MW: 18.5 kDa
• Gene Summary: Required during spermatogenesis and placenta development, participating in the repression of retrotransposable elements and prevent their mobilization. Collaborates with the Piwi-interacting RNA (piRNA) pathway, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins. Interacts with Piwi proteins and directly binds piRNAs, a class of 24 to 30 nucleotide RNAs that are generated by a Dicer-independent mechanism and are primarily derived from transposons and other repeated sequence elements. Also during spermatogenesis, promotes, with UBR2, SPO11-dependent recombination foci to accumulate and drive robust homologous chromosome synapsis (By similarity). Interacts with LINE-1 retrotransposon encoded LIRE1, stimulates LIRE1 polyubiquitination, mediated by UBR2, and degradation, inhibiting LINE-1 retranstoposon mobilization (PubMed:28806172).[UniProtKB/Swiss-Prot Function]