IL21 Receptor (IL21R) (NM_181079) Human Untagged Clone

CAT#: SC307245

IL21R (untagged)-Human interleukin 21 receptor (IL21R), transcript variant 3


  "NM_181079" in other vectors (4)

Reconstitution Protocol

USD 574.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal IL-21 Receptor Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "IL21 Receptor"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL21 Receptor
Synonyms CD360; IMD56; NILR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307245 representing NM_181079.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTGTCGCTGCATCTTTCTCATGAAGCACGGGGAACGGGTCGGATGGCCCGTGGGAGTCAGCATG
CCGCGTGGCTGGGCCGCCCCCTTGCTCCTGCTGCTGCTCCAGGGAGGCTGGGGCTGCCCCGACCTCGTC
TGCTACACCGATTACCTCCAGACGGTCATCTGCATCCTGGAAATGTGGAACCTCCACCCCAGCACGCTC
ACCCTTACCTGGCAAGACCAGTATGAAGAGCTGAAGGACGAGGCCACCTCCTGCAGCCTCCACAGGTCG
GCCCACAATGCCACGCATGCCACCTACACCTGCCACATGGATGTATTCCACTTCATGGCCGACGACATT
TTCAGTGTCAACATCACAGACCAGTCTGGCAACTACTCCCAGGAGTGTGGCAGCTTTCTCCTGGCTGAG
AGCATCAAGCCGGCTCCCCCTTTCAACGTGACTGTGACCTTCTCAGGACAGTATAATATCTCCTGGCGC
TCAGATTACGAAGACCCTGCCTTCTACATGCTGAAGGGCAAGCTTCAGTATGAGCTGCAGTACAGGAAC
CGGGGAGACCCCTGGGCTGTGAGTCCGAGGAGAAAGCTGATCTCAGTGGACTCAAGAAGTGTCTCCCTC
CTCCCCCTGGAGTTCCGCAAAGACTCGAGCTATGAGCTGCAGGTGCGGGCAGGGCCCATGCCTGGCTCC
TCCTACCAGGGGACCTGGAGTGAATGGAGTGACCCGGTCATCTTTCAGACCCAGTCAGAGGAGTTAAAG
GAAGGCTGGAACCCTCACCTGCTGCTTCTCCTCCTGCTTGTCATAGTCTTCATTCCTGCCTTCTGGAGC
CTGAAGACCCATCCATTGTGGAGGCTATGGAAGAAGATATGGGCCGTCCCCAGCCCTGAGCGGTTCTTC
ATGCCCCTGTACAAGGGCTGCAGCGGAGACTTCAAGAAATGGGTGGGTGCACCCTTCACTGGCTCCAGC
CTGGAGCTGGGACCCTGGAGCCCAGAGGTGCCCTCCACCCTGGAGGTGTACAGCTGCCACCCACCACGG
AGCCCGGCCAAGAGGCTGCAGCTCACGGAGCTACAAGAACCAGCAGAGCTGGTGGAGTCTGACGGTGTG
CCCAAGCCCAGCTTCTGGCCGACAGCCCAGAACTCGGGGGGCTCAGCTTACAGTGAGGAGAGGGATCGG
CCATACGGCCTGGTGTCCATTGACACAGTGACTGTGCTAGATGCAGAGGGGCCATGCACCTGGCCCTGC
AGCTGTGAGGATGACGGCTACCCAGCCCTGGACCTGGATGCTGGCCTGGAGCCCAGCCCAGGCCTAGAG
GACCCACTCTTGGATGCAGGGACCACAGTCCTGTCCTGTGGCTGTGTCTCAGCTGGCAGCCCTGGGCTA
GGAGGGCCCCTGGGAAGCCTCCTGGACAGACTAAAGCCACCCCTTGCAGATGGGGAGGACTGGGCTGGG
GGACTGCCCTGGGGTGGCCGGTCACCTGGAGGGGTCTCAGAGAGTGAGGCGGGCTCACCCCTGGCCGGC
CTGGATATGGACACGTTTGACAGTGGCTTTGTGGGCTCTGACTGCAGCAGCCCTGTGGAGTGTGACTTC
ACCAGCCCCGGGGACGAAGGACCCCCCCGGAGCTACCTCCGCCAGTGGGTGGTCATTCCTCCGCCACTT
TCGAGCCCTGGACCCCAGGCCAGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_181079
Insert Size 1683 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181079.4
RefSeq Size 5006 bp
RefSeq ORF 1683 bp
Locus ID 50615
UniProt ID Q9HBE5
Cytogenetics 16p12.1
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
MW 61.6 kDa
Gene Summary The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (3) has an additional exon in the 5' region, resulting in an upstream AUG start codon, as compared to variant 1. The resulting isoform (2) has a longer N-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.