SMRP1 (C9orf24) (NM_147168) Human Untagged Clone

CAT#: SC306299

C9orf24 (untagged)-Human chromosome 9 open reading frame 24 (C9orf24), transcript variant 2


  "NM_147168" in other vectors (4)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-C9orf24 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "C9orf24"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C9orf24
Synonyms bA573M23.4; CBE1; NYD-SP22; SMRP1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_147168, the custom clone sequence may differ by one or more nucleotides
ATGGAGACAGCAGTTCGAGGAATGCCCTTGGAATGCCCTCCTAGGCCGGAGCGGCTCAAT
GCCTACGAGCGCGAAGTGATGGTGAACATGCTGAACTCACTGTCGCGGAACCAGCAGCTG
CCGCGGATCACGCCCCGATGCGGGTGCGTGGACCCGCTGCCCGGCCGCCTGCCCTTCCAT
GGTTACGAAAGTGCTTGCTCGGGCCGCCACTACTGTCTGCGCGGGATGGACTACTACGCC
AGCGGGGCGCCCTGCACCGACCGCCGCCTGCGGCCTTGGTGCCGGGAGCAACCGACTATG
TGTACCTCCCTACGAGCACCGGCCCGGAATGCAGTGTGCTGTTACAACTCCCCCGCCGTC
ATACTACCCATATCCGAACCTTAG
Restriction Sites Please inquire     
ACCN NM_147168
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_147168.1, NP_671697.1
RefSeq Size 726 bp
RefSeq ORF 384 bp
Locus ID 84688
UniProt ID Q8NCR6
Cytogenetics 9p13.3
Gene Summary This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.