SMRP1 (C9orf24) (NM_147168) Human Untagged Clone
CAT#: SC306299
C9orf24 (untagged)-Human chromosome 9 open reading frame 24 (C9orf24), transcript variant 2
"NM_147168" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C9orf24 |
Synonyms | bA573M23.4; CBE1; NYD-SP22; SMRP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_147168, the custom clone sequence may differ by one or more nucleotides
ATGGAGACAGCAGTTCGAGGAATGCCCTTGGAATGCCCTCCTAGGCCGGAGCGGCTCAAT GCCTACGAGCGCGAAGTGATGGTGAACATGCTGAACTCACTGTCGCGGAACCAGCAGCTG CCGCGGATCACGCCCCGATGCGGGTGCGTGGACCCGCTGCCCGGCCGCCTGCCCTTCCAT GGTTACGAAAGTGCTTGCTCGGGCCGCCACTACTGTCTGCGCGGGATGGACTACTACGCC AGCGGGGCGCCCTGCACCGACCGCCGCCTGCGGCCTTGGTGCCGGGAGCAACCGACTATG TGTACCTCCCTACGAGCACCGGCCCGGAATGCAGTGTGCTGTTACAACTCCCCCGCCGTC ATACTACCCATATCCGAACCTTAG |
Restriction Sites | Please inquire |
ACCN | NM_147168 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_147168.1, NP_671697.1 |
RefSeq Size | 726 bp |
RefSeq ORF | 384 bp |
Locus ID | 84688 |
UniProt ID | Q8NCR6 |
Cytogenetics | 9p13.3 |
Gene Summary | This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218733 | C9orf24 (Myc-DDK-tagged)-Human chromosome 9 open reading frame 24 (C9orf24), transcript variant 2 |
USD 330.00 |
|
RC218733L3 | Lenti-ORF clone of C9orf24 (Myc-DDK-tagged)-Human chromosome 9 open reading frame 24 (C9orf24), transcript variant 2 |
USD 630.00 |
|
RC218733L4 | Lenti-ORF clone of C9orf24 (mGFP-tagged)-Human chromosome 9 open reading frame 24 (C9orf24), transcript variant 2 |
USD 630.00 |
|
RG218733 | C9orf24 (tGFP-tagged) - Human chromosome 9 open reading frame 24 (C9orf24), transcript variant 2 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review