PHOS (PDC) (NM_022576) Human Untagged Clone

CAT#: SC305039

PDC (untagged)-Human phosducin (PDC), transcript variant 2


  "NM_022576" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PDC Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PHOS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHOS
Synonyms MEKA; PHD; PhLOP; PhLP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305039 representing NM_022576.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTTCTCCTCAGAGTAGGAATGGCAAAGATTCAAAGGAACGAGTCAGCAGAAAGATGAGCATTCAA
GAATATGAACTAATCCATAAAGAGAAAGAGGATGAAAACTGCCTTCGTAAATACCGTAGACAGTGTATG
CAGGATATGCACCAGAAGCTGAGTTTTGGGCCTAGATATGGGTTTGTGTATGAGCTGGAAACTGGAAAG
CAATTCCTAGAAACAATTGAAAAGGAACTGAAGATCACCACAATTGTTGTTCACATTTATGAAGATGGT
ATTAAGGGTTGTGATGCTCTAAACAGTAGTTTAACATGCCTTGCAGCAGAATACCCTATAGTTAAGTTT
TGTAAAATAAAAGCTTCGAATACAGGTGCTGGGGACCGCTTTTCCTTAGATGTACTTCCTACACTGCTC
ATCTATAAAGGTGGGGAACTCATAAGCAATTTTATTAGTGTTGCTGAACAGTTTGCTGAAGAATTTTTT
GCTGGGGATGTGGAGTCTTTCCTAAATGAATATGGGTTACTACCTGAAAGAGAGGTACATGTCCTAGAG
CATACCAAAATAGAAGAAGAAGATGTTGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_022576
Insert Size 585 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022576.3
RefSeq Size 1208 bp
RefSeq ORF 585 bp
Locus ID 5132
UniProt ID P20941
Cytogenetics 1q31.1
Protein Families Druggable Genome
Protein Pathways Olfactory transduction
MW 22.3 kDa
Gene Summary This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2), also known as PHLOP1, has an alternate 5' sequence, resulting in a downstream AUG start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.