Folate Binding Protein (FOLR1) (NM_016729) Human Untagged Clone
CAT#: SC304447
FOLR1 (untagged)-Human folate receptor 1 (adult) (FOLR1), transcript variant 4
"NM_016729" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FOLR1 |
Synonyms | FBP; FOLR; FRalpha; NCFTD |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_016729, the custom clone sequence may differ by one or more nucleotides
ATGGCTCAGCGGATGACAACACAGCTGCTGCTCCTTCTAGTGTGGGTGGCTGTAGTAGGG GAGGCTCAGACAAGGATTGCATGGGCCAGGACTGAGCTTCTCAATGTCTGCATGAACGCC AAGCACCACAAGGAAAAGCCAGGCCCCGAGGACAAGTTGCATGAGCAGTGTCGACCCTGG AGGAAGAATGCCTGCTGTTCTACCAACACCAGCCAGGAAGCCCATAAGGATGTTTCCTAC CTATATAGATTCAACTGGAACCACTGTGGAGAGATGGCACCTGCCTGCAAACGGCATTTC ATCCAGGACACCTGCCTCTACGAGTGCTCCCCCAACTTGGGGCCCTGGATCCAGCAGGTG GATCAGAGCTGGCGCAAAGAGCGGGTACTGAACGTGCCCCTGTGCAAAGAGGACTGTGAG CAATGGTGGGAAGATTGTCGCACCTCCTACACCTGCAAGAGCAACTGGCACAAGGGCTGG AACTGGACTTCAGGGTTTAACAAGTGCGCAGTGGGAGCTGCCTGCCAACCTTTCCATTTC TACTTCCCCACACCCACTGTTCTGTGCAATGAAATCTGGACTCACTCCTACAAGGTCAGC AACTACAGCCGAGGGAGTGGCCGCTGCATCCAGATGTGGTTCGACCCAGCCCAGGGCAAC CCCAATGAGGAGGTGGCGAGGTTCTATGCTGCAGCCATGAGTGGGGCTGGGCCCTGGGCA GCCTGGCCTTTCCTGCTTAGCCTGGCCCTAATGCTGCTGTGGCTGCTCAGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_016729 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016729.1, NP_057941.1 |
RefSeq Size | 939 bp |
RefSeq ORF | 774 bp |
Locus ID | 2348 |
UniProt ID | P15328 |
Cytogenetics | 11q13.4 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 7. Variants 1, 2, 4 and 7 all encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221107 | FOLR1 (Myc-DDK-tagged)-Human folate receptor 1 (adult) (FOLR1), transcript variant 4 |
USD 300.00 |
|
RC221107L3 | Lenti-ORF clone of FOLR1 (Myc-DDK-tagged)-Human folate receptor 1 (adult) (FOLR1), transcript variant 4 |
USD 600.00 |
|
RC221107L4 | Lenti-ORF clone of FOLR1 (mGFP-tagged)-Human folate receptor 1 (adult) (FOLR1), transcript variant 4 |
USD 600.00 |
|
RG221107 | FOLR1 (tGFP-tagged) - Human folate receptor 1 (adult) (FOLR1), transcript variant 4 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review