KCNK9 (NM_016601) Human Untagged Clone

CAT#: SC304437

KCNK9 (untagged)-Human potassium channel, subfamily K, member 9 (KCNK9)


  "NM_016601" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
KCNK9 Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "KCNK9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNK9
Synonyms K2p9.1; KT3.2; TASK-3; TASK3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_016601 edited
CCATGAAGAGGCAGAACGTGCGGACTCTGTCCCTCATCGTCTGCACCTTCACCTACCTGC
TGGTGGGCGCCGCCGTGTTCGACGCCCTCGAGTCGGACCACGAGATGCGCGAGGAGGAGA
AACTCAAAGCCGAGGAGATCCGGATCAAGGGGAAGTACAACATCAGCAGCGAGGACTACC
GGCAGCTGGAGCTGGTGATCCTGCAGTCGGAACCGCACCGCGCCGGCGTCCAGTGGAAAT
TCGCCGGCTCCTTCTACTTTGCGATCACGGTCATCACCACCATAGGTTATGGGCACGCTG
CACCTGGCACCGATGCGGGCAAGGCCTTCTGCATGTTCTACGCCGTGCTGGGCATCCCGC
TGACACTGGTCATGTTCCAGAGCCTGGGCGAGCGCATGAACACCTTCGTGCGCTACCTGC
TGAAGCGCATTAAGAAGTGCTGTGGCATGCGCAACACTGACGTGTCTATGGAGAACATGG
TGACTGTGGGCTTCTTCTCCTGCATGGGGACGCTGTGCATCGGGGCGGCCGCCTTCTCCC
AGTGTGAGGAGTGGAGCTTCTTCCACGCCTACTACTACTGCTTCATCACGTTGACTACCA
TTGGGTTCGGGGACTACGTGGCCCTGCAGACCAAGGGTGCCCTGCAGAAGAAGCCGCTCT
ACGTGGCCTTTAGCTTTATGTATATCCTGGTGGGGCTGACGGTCATCGGGGCCTTCCTCA
ACCTGGTCGTCCTCAGGTTCTTGACCATGAACAGTGAGGATGAGCGGCGGGATGCTGAAG
AGAGGGCATCCCTCGCCGGAAACCGCAACAGCATGGTCATTCACATCCCTGAGGAGCCGC
GGCCCAGCCGGCCCAGGTACAAGGCGGACGTCCCGGACCTGCAGTCTGTGTGCTCCTGCA
CCTGCTACCGCTCGCAGGACTATGGCGGCCGCTCGGTGGCACCGCAGAACTCCTTCAGCG
CCAAGCTTGCCCCCCACTACTTCCACTCCATCTCTTACAAGATCGAGGAGATCTCACCAA
GCACATTAAAAAACAGCCTCTTCCCATCGCCTATTAGCTCCATCTCTCCTGGGTTACACA
GCTTTACCGACCACCAGAGGCTGATGAAACGCCGGAAGTCCGTTTAGGGGAACTAACTGC
ACATTCAAGAGAG
Restriction Sites Please inquire     
ACCN NM_016601
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016601.2, NP_057685.1
RefSeq Size 1303 bp
RefSeq ORF 1125 bp
Locus ID 51305
Cytogenetics 8q24.3
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary This gene encodes a protein that contains multiple transmembrane regions and two pore-forming P domains and functions as a pH-dependent potassium channel. Amplification and overexpression of this gene have been observed in several types of human carcinomas. This gene is imprinted in the brain, with preferential expression from the maternal allele. A mutation in this gene was associated with Birk-Barel dysmorphism syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (2) represents an alternate 3' exon structure, which may not be complete, compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.