RPA4 (NM_013347) Human Untagged Clone

CAT#: SC303998

RPA4 (untagged)-Human replication protein A4, 30kDa (RPA4)


  "NM_013347" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-RPA4 Antibody
    • 100 ul

USD 539.00

Other products for "RPA4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPA4
Synonyms HSU24186
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303998 representing NM_013347.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTAAGAGTGGGTTTGGGAGCTATGGCAGCATTTCTGCTGCTGATGGAGCGAGTGGAGGCAGTGAC
CAACTGTGTGAGAGAGATGCAACTCCTGCTATTAAGACCCAAAGACCTAAGGTCCGAATTCAGGACGTT
GTACCGTGTAATGTGAACCAGCTTCTCAGCTCTACTGTGTTTGACCCTGTGTTCAAGGTTAGGGGAATT
ATAGTTTCCCAGGTCTCCATCGTGGGGGTAATCAGAGGGGCAGAGAAGGCTTCAAATCACATTTGTTAC
AAAATTGATGATATGACCGCGAAACCAATCGAGGCCCGACAGTGGTTTGGTAGAGAGAAAGTCAAGCAG
GTGACTCCATTGTCAGTCGGAGTATATGTCAAAGTGTTTGGTATCCTCAAATGTCCCACGGGAACAAAG
AGCCTTGAGGTATTGAAAATTCATGTCCTAGAGGACATGAACGAGTTCACCGTGCATATTCTGGAAACG
GTCAATGCACACATGATGCTGGATAAAGCCCGTCGTGATACCACTGTAGAAAGTGTGCCTGTGTCTCCA
TCAGAAGTGAATGATGCTGGGGATAACGATGAGAGTCACCGCAATTTCATCCAGGACGAAGTGCTGCGT
TTGATTCATGAGTGTCCTCATCAGGAAGGGAAGAGCATCCATGAGCTCCGGGCTCAGCTCTGCGACCTT
AGCGTCAAGGCCATCAAGGAAGCGATTGATTATCTGACCGTTGAGGGCCACATCTATCCCACTGTGGAT
CGGGAGCATTTTAAGTCTGCTGATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_013347
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013347.4
RefSeq Size 1560 bp
RefSeq ORF 786 bp
Locus ID 29935
UniProt ID Q13156
Cytogenetics Xq21.33
Protein Families Druggable Genome
Protein Pathways DNA replication, Homologous recombination, Mismatch repair, Nucleotide excision repair
MW 28.9 kDa
Gene Summary This gene encodes a single-stranded DNA-binding protein that is the 30-kDa subunit of the replication protein A complex. Replication protein A is an essential factor for DNA double-strand break repair and cell cycle checkpoint activation. The encoded protein localizes to DNA repair foci and may be involved in the cellular DNA damage response. This protein may also play a role in inhibiting viral replication.[provided by RefSeq, Apr 2010]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.