ITGB1BP2 (NM_012278) Human Untagged Clone

CAT#: SC303950

ITGB1BP2 (untagged)-Human integrin beta 1 binding protein (melusin) 2 (ITGB1BP2)


  "NM_012278" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-ITGB1BP2 Antibody
    • 100 ul

USD 485.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ITGB1BP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ITGB1BP2
Synonyms CHORDC3; ITGB1BP; MELUSIN; MSTP015
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303950 representing NM_012278.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTCTACTCTGTCGTAACAAAGGCTGTGGGCAGCACTTTGACCCTAATACCAACCTTCCTGATTCC
TGTTGCCATCACCCTGGGGTCCCAATCTTCCATGATGCACTTAAGGGTTGGTCCTGCTGCCGAAAGCGA
ACTGTAGATTTCTCTGAGTTCTTAAACATCAAGGGCTGTACTATGGGACCACACTGTGCTGAGAAGCTT
CCTGAGGCCCCTCAACCTGAAGGCCCTGCTACAAGCAGTTCACTTCAGGAGCAAAAACCTCTGAATGTG
ATTCCAAAGTCAGCAGAGACCTTGCGCCGGGAGAGGCCCAAGTCAGAGTTGCCTCTGAAGCTGCTGCCG
CTAAATATATCCCAAGCCCTGGAAATGGCATTGGAACAGAAGGAATTAGACCAGGAACCTGGGGCAGGA
CTTGACAGTCTGATCCGGACTGGTTCCAGCTGCCAGAACCCAGGATGTGATGCTGTTTACCAAGGCCCT
GAGAGTGATGCTACTCCATGTACCTACCACCCAGGAGCACCCCGATTCCATGAGGGGATGAAGTCTTGG
AGCTGTTGTGGCATCCAGACCCTGGATTTTGGGGCATTCTTGGCACAACCAGGGTGCAGAGTCGGTAGA
CATGACTGGGGGAAGCAGCTCCCAGCATCTTGCCGCCATGATTGGCACCAGACAGATTCCTTAGTAGTG
GTGACTGTATATGGCCAGATTCCACTTCCTGCGTTTAACTGGGTGAAGGCCAGTCAAACTGAGCTTCAT
GTCCACATTGTCTTTGATGGTAACCGTGTGTTCCAAGCACAGATGAAGCTCTGGGGGGTCATAAACGTG
GAGCAGAGCTCTGTCTTCTTGATGCCATCTCGGGTTGAAATCTCCCTGGTCAAGGCTGACCCAGGATCC
TGGGCCCAGCTGGAGCACCCTGATGCACTAGCTAAGAAGGCTAGGGCAGGGGTTGTGTTAGAGATGGAT
GAGGAAGAATCTGACGATTCAGATGATGATCTGAGCTGGACAGAGGAGGAGGAAGAGGAGGAAGCAATG
GGGGAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_012278
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_012278.2
RefSeq Size 1292 bp
RefSeq ORF 1044 bp
Locus ID 26548
UniProt ID Q9UKP3
Cytogenetics Xq13.1
MW 38.4 kDa
Gene Summary This gene encodes a protein with two cysteine and histidine-rich (CHORD) domains, PXXP motifs, YXXI/P motifs, putative SH2 and SH3 domain binding motifs, and an acidic region at the C-terminus that can bind calcium. Two hybrid analysis showed that this protein interacts with the cytoplasmic domain of the beta 1 integrin subunit and is thought to act as a chaperone protein. Studies in the mouse ortholog of this gene indicate that absence of this gene in mouse results in failed cardiac hypertrophy in response to mechanical stress. Alternative splicing results in multiple transcript variants encoding different isoforms, including an isoform that lacks several domains, including one of the CHORD domains. [provided by RefSeq, May 2017]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.