SRA1 (NM_001035235) Human Untagged Clone
CAT#: SC302827
SRA1 (untagged)-Human steroid receptor RNA activator 1 (SRA1)
"NM_001035235" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SRA1 |
Synonyms | pp7684; SRA; SRAP; STRAA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302827 representing NM_001035235.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACGCGCTGCCCCGCTGGCCAAGCGGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAG GAACGCGGCTGGAACGACCCGCCGCAGTTCTCATACGGGCTGCAGACCCAGGCCGGCGGACCCAGGCGC TCGCTGCTTACCAAGAGGGTCGCCGCACCCCAGGATGGATCCCCCAGAGTCCCCGCATCAGAGACTTCT CCTGGGCCTCCCCCAATGGGGCCTCCACCTCCTTCAAGTAAGGCTCCCAGGTCCCCACCTGTGGGGAGT GGTCCTGCCTCTGGCGTGGAGCCCACAAGTTTCCCAGTCGAGTCTGAGGCTGTGATGGAGGATGTGCTG AGACCTTTGGAACAGGCATTGGAAGACTGCCGTGGCCACACAAGGAAGCAGGTATGTGATGACATCAGC CGACGCCTGGCACTGCTGCAGGAACAGTGGGCTGGAGGAAAGTTGTCAATACCTGTAAAGAAGAGAATG GCTCTACTGGTGCAAGAGCTTTCAAGCCACCGGTGGGACGCAGCAGATGACATCCACCGCTCCCTCATG GTTGACCATGTGACTGAGGTCAGTCAGTGGATGGTAGGAGTTAAAAGATTAATTGCAGAAAAGAGGAGT CTGTTTTCAGAGGAGGCAGCCAATGAAGAGAAATCTGCAGCCACAGCTGAGAAGAACCATACCATACCA GGCTTCCAGCAGGCTTCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001035235 |
Insert Size | 711 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001035235.3 |
RefSeq Size | 1955 bp |
RefSeq ORF | 711 bp |
Locus ID | 10011 |
UniProt ID | Q9HD15 |
Cytogenetics | 5q31.3 |
MW | 25.7 kDa |
Gene Summary | Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220899 | SRA1 (Myc-DDK-tagged)-Human steroid receptor RNA activator 1 (SRA1) |
USD 618.00 |
|
RC220899L1 | Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), Myc-DDK-tagged |
USD 918.00 |
|
RC220899L2 | Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), mGFP tagged |
USD 918.00 |
|
RC220899L3 | Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), Myc-DDK-tagged |
USD 918.00 |
|
RC220899L4 | Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), mGFP tagged |
USD 918.00 |
|
RG220899 | SRA1 (tGFP-tagged) - Human steroid receptor RNA activator 1 (SRA1) |
USD 818.00 |
{0} Product Review(s)
Be the first one to submit a review