LAP2 (TMPO) (NM_001032283) Human Untagged Clone

CAT#: SC302623

TMPO (untagged)-Human thymopoietin (TMPO), transcript variant 2


  "NM_001032283" in other vectors (6)

Reconstitution Protocol

USD 732.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit anti-TMPO Polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "LAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LAP2
Synonyms CMD1T; LAP2; LEMD4; PRO0868; TP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302623 representing NM_001032283.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGAGTTCCTGGAAGACCCCTCGGTCCTGACAAAAGACAAGTTGAAGAGTGAGTTGGTCGCCAAC
AATGTGACGCTGCCGGCCGGGGAGCAGCGCAAAGACGTGTACGTCCAGCTCTACCTGCAGCACCTCACG
GCTCGCAACCGGCCGCCGCTCCCCGCCGGCACCAACAGCAAGGGGCCCCCGGACTTCTCCAGTGACGAA
GAGCGCGAGCCCACCCCGGTCCTCGGCTCTGGGGCCGCCGCCGCGGGCCGGAGCCGAGCAGCCGTCGGC
AGGAAAGCCACAAAAAAAACTGATAAACCCAGACAAGAAGATAAAGATGATCTAGATGTAACAGAGCTC
ACTAATGAAGATCTTTTGGATCAGCTTGTGAAATACGGAGTGAATCCTGGTCCTATTGTGGGAACAACC
AGGAAGCTATATGAGAAAAAGCTTTTGAAACTGAGGGAACAAGGAACAGAATCAAGATCTTCTACTCCT
CTGCCAACAATTTCTTCTTCAGCAGAAAATACAAGGCAGAATGGAAGTAATGATTCTGACAGATACAGT
GACAATGAAGAAGACTCTAAAATAGAGCTCAAGCTTGAGAAGAGAGAACCACTAAAGGGCAGAGCAAAG
ACTCCAGTAACACTCAAGCAAAGAAGAGTTGAGCACAATCAGAGCTATTCTCAAGCTGGAATAACTGAG
ACTGAATGGACAAGTGGATCTTCAAAAGGCGGACCTCTGCAGGCATTAACTAGGGAATCTACAAGAGGG
TCAAGAAGAACTCCAAGGAAAAGGGTGGAAACTTCAGAACATTTTCGTATAGATGGTCCAGTAATTTCA
GAGAGTACTCCCATAGCTGAAACTATAATGGCTTCAAGCAACGAATCCTTAGTTGTCAATAGGGTGACT
GGAAATTTCAAGCATGCATCTCCTATTCTGCCAATCACTGAATTCTCAGACATACCCAGAAGAGCACCA
AAGAAACCATTGACAAGAGCTGAAGTGGGAGAAAAAACAGAGGAAAGAAGAGTAGAAAGGGATATTCTT
AAGGAAATGTTCCCCTATGAAGCATCTACACCAACAGGAATTAGTGCTAGTTGCCGCAGACCAATCAAA
GGGGCTGCAGGCCGGCCATTAGAACTCAGTGATTTCAGGATGGAGGAGTCTTTTTCATCTAAATATGTT
CCTAAGTATGTTCCCTTGGCAGATGTCAAGTCAGAAAAGACAAAAAAGGGACGCTCCATTCCCGTATGG
ATAAAAATTTTGCTGTTTGTTGTTGTGGCAGTTTTTTTGTTTTTGGTCTATCAAGCTATGGAAACCAAC
CAAGTAAATCCCTTCTCTAATTTTCTTCATGTTGACCCTAGAAAATCCAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001032283
Insert Size 1365 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001032283.2
RefSeq Size 4186 bp
RefSeq ORF 1365 bp
Locus ID 7112
UniProt ID P42167
Cytogenetics 12q23.1
Protein Families Stem cell - Pluripotency, Transmembrane
MW 50.7 kDa
Gene Summary Through alternative splicing, this gene encodes several distinct LEM domain containing protein isoforms. LEM domain proteins include inner nuclear membrane and intranuclear proteins, and are involved in a variety of cellular functions including gene expression, chromatin organization, and replication and cell cycle control. The encoded alpha isoform is broadly diffuse in the nucleus and contains a lamin binding domain, while the beta and gamma isoforms are localized to the nuclear membrane and contain an HDAC3 interaction domain. The distinct isoforms may compete with each other when acting to chaperone other proteins and regulate transcription. [provided by RefSeq, Aug 2019]
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1, resulting in a shorter isoform (beta) with a distinct C-terminus compared to isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.