TrkB (NTRK2) (NM_001018066) Human Untagged Clone

CAT#: SC302154

NTRK2 (untagged)-Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant e


  "NM_001018066" in other vectors (4)

Reconstitution Protocol

USD 551.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-NTRK2 (TrkB ) mouse monoclonal antibody, clone OTI2E1 (formerly 2E1)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TrkB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TrkB
Synonyms DEE58; EIEE58; GP145-TrkB; OBHD; trk-B; TRKB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302154 representing NM_001018066.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGTCCTGGATAAGGTGGCATGGACCCGCCATGGCGCGGCTCTGGGGCTTCTGCTGGCTGGTTGTG
GGCTTCTGGAGGGCCGCTTTCGCCTGTCCCACGTCCTGCAAATGCAGTGCCTCTCGGATCTGGTGCAGC
GACCCTTCTCCTGGCATCGTGGCATTTCCGAGATTGGAGCCTAACAGTGTAGATCCTGAGAACATCACC
GAAATTTTCATCGCAAACCAGAAAAGGTTAGAAATCATCAACGAAGATGATGTTGAAGCTTATGTGGGA
CTGAGAAATCTGACAATTGTGGATTCTGGATTAAAATTTGTGGCTCATAAAGCATTTCTGAAAAACAGC
AACCTGCAGCACATCAATTTTACCCGAAACAAACTGACGAGTTTGTCTAGGAAACATTTCCGTCACCTT
GACTTGTCTGAACTGATCCTGGTGGGCAATCCATTTACATGCTCCTGTGACATTATGTGGATCAAGACT
CTCCAAGAGGCTAAATCCAGTCCAGACACTCAGGATTTGTACTGCCTGAATGAAAGCAGCAAGAATATT
CCCCTGGCAAACCTGCAGATACCCAATTGTGGTTTGCCATCTGCAAATCTGGCCGCACCTAACCTCACT
GTGGAGGAAGGAAAGTCTATCACATTATCCTGTAGTGTGGCAGGTGATCCGGTTCCTAATATGTATTGG
GATGTTGGTAACCTGGTTTCCAAACATATGAATGAAACAAGCCACACACAGGGCTCCTTAAGGATAACT
AACATTTCATCCGATGACAGTGGGAAGCAGATCTCTTGTGTGGCGGAAAATCTTGTAGGAGAAGATCAA
GATTCTGTCAACCTCACTGTGCATTTTGCACCAACTATCACATTTCTCGAATCTCCAACCTCAGACCAC
CACTGGTGCATTCCATTCACTGTGAAAGGCAACCCCAAACCAGCGCTTCAGTGGTTCTATAACGGGGCA
ATATTGAATGAGTCCAAATACATCTGTACTAAAATACATGTTACCAATCACACGGAGTACCACGGCTGC
CTCCAGCTGGATAATCCCACTCACATGAACAATGGGGACTACACTCTAATAGCCAAGAATGAGTATGGG
AAGGATGAGAAACAGATTTCTGCTCACTTCATGGGCTGGCCTGGAATTGACGATGGTGCAAACCCAAAT
TATCCTGATGTAATTTATGAAGATTATGGAACTGCAGCGAATGACATCGGGGACACCACGAACAGAAGT
AATGAAATCCCTTCCACAGACGTCACTGATAAAACCGGTCGGGAACATCTCTCGGTCTATGCTGTGGTG
GTGATTGCGTCTGTGGTGGGATTTTGCCTTTTGGTAATGCTGTTTCTGCTTAAGTTGGCAAGACACTCC
AAGTTTGGCATGAAAGGCCCAGCCTCCGTTATCAGCAATGATGATGACTCTGCCAGCCCACTCCATCAC
ATCTCCAATGGGAGTAACACTCCATCTTCTTCGGAAGGTGGCCCAGATGCTGTCATTATTGGAATGACC
AAGATCCCTGTCATTGAAAATCCCCAGTACTTTGGCATCACCAACAGTCAGCTCAAGCCAGACACATGG
CCCAGAGGTTCCCCCAAGACCGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001018066
Insert Size 1614 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018066.2
RefSeq Size 8292 bp
RefSeq ORF 1614 bp
Locus ID 4915
UniProt ID Q16620
Cytogenetics 9q21.33
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways MAPK signaling pathway, Neurotrophin signaling pathway
MW 59.2 kDa
Gene Summary This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (e) lacks an alternate in-frame exon in the central coding region, and also lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant a. The encoded isoform (e, also known as TrkB-T-Shc) has a distinct C-terminus and is shorter than isoform a. The 5' UTR is incomplete due to a lack of 5'-complete transcript support for this variant, and because there is ambiguity in the 5' UTR splicing pattern. Variants e and n both encode the same isoform (e). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.