Hrh3 (NM_001270570) Rat Untagged Clone

CAT#: RN216431

Hrh3 (untagged) - Rat histamine receptor H3 (Hrh3), transcript variant 8

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Hrh3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN216431 representing NM_001270570
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGCGCGCGCCGCCCGACGGGCTGATGAACGCGTCGGGCACTCTGGCCGGAGAGGCGGCGGCTGCAG
  GCGGGGCGCGCGGCTTCTCGGCTGCCTGGACCGCTGTCCTGGCTGCGCTCATGGCGCTGCTCATCGTGGC
  CACAGTACTGGGCAACGCGCTGGTCATGCTCGCCTTCGTGGCGGATTCGAGCCTCCGCACCCAGAACAAC
  TTCTTTCTGCTCAACCTCGCCATCTCCGACTTCCTCGTGGGTGCCTTCTGCATCCCATTGTACGTACCCT
  ATGTGCTGACCGGCCGTTGGACCTTCGGCCGGGGCCTCTGCAAGCTGTGGCTGGTGGTAGACTACCTACT
  GTGTGCCTCCTCGGTCTTCAACATCGTACTCATCAGCTATGACCGATTCCTGTCAGTCACTCGAGCTGTC
  TCCTACAGGGCCCAGCAGGGGGACACGAGACGGGCCGTTCGGAAGATGGCACTGGTGTGGGTGCTGGCCT
  TCCTGCTGTATGGGCCTGCCATCCTGAGTTGGGAGTACCTGTCTGGTGGCAGTTCCATCCCCGAGGGCCA
  CTGCTATGCTGAGTTCTTCTACAACTGGTACTTTCTCATCACGGCCTCCACCCTCGAGTTCTTCACGCCC
  TTCCTCAGCGTTACCTTCTTCAACCTCAGCATCTACCTGAACATCCAGAGGCGCACCCGCCTTCGGCTTG
  ATGGGGGCCGTGAGGCTGGCCCAGAACCCCCACCAGATGCCCAGCCCTCGCCACCTCCAGCTCCCCCCAG
  CTGCTGGGGCTGCTGGCCAAAAGGGCATGGCGAGGCCATGCCGTTGCACAGGGGCTCCAAGCCATCAGCA
  TCTTCAGCATCCCTGGAGAAGCGCATGAAGATGGTGTCCCAGAGCATCACCCAGCGCTTCCGGCTGTCGC
  GGGACAAGAAGGTGGCCAAGTCGCTGGCCATCATCGTGAGCATCTTTGGGCTCTGCTGGGCGCCGTACAC
  GCTCCTAATGATCATCCGAGCTGCTTGCCATGGCCGCTGCATCCCCGATTACTGA
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001270570
• Insert Size: 1035 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270570.1, NP_001257499.1
• RefSeq Size: 1956 bp
• RefSeq ORF: 1035 bp
• Locus ID: 85268
• Cytogenetics: 3q43
• Gene Summary: This gene encodes a histamine H3 receptor that belongs to the superfamily of G-protein coupled receptors. This protein functions as a presynaptic autoreceptor on histamine neurons in the brain, and a presynaptic heteroreceptor in nonhistamine-containing neurons in both the central and peripheral nervous systems. It is deemed a great target for the development of therapeutics for numerous disorders, including obesity, epilepsy, and such cognitive diseases as attention deficit hyperactivity disorder and Alzheimer's disease. Several alternatively spliced transcript variants encoding different isoforms, with different brain expression patterns and signaling properties, have been described for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (8) is alternatively spliced at the 3' end and uses an alternate acceptor splice site at the 3' terminal exon compared to variant 1. The latter causes a frame-shift, and a shorter isoform (8) containing 6 transmembrane domains and missing part of the third intracellular loop compared to isoform H3A.