Aqp4 (NM_001270559) Rat Untagged Clone

CAT#: RN216132

Aqp4 (untagged) - Rat aquaporin 4 (Aqp4), transcript variant 4


  "NM_001270559" in other vectors (1)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal Anti-Aquaporin 4 (300-314)
    • 50 ul

USD 850.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Aqp4"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Aqp4
Synonyms AQP-4; Miwc; WCH4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216132 representing NM_001270559
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGGCTTTCAAAGGCGTCTGGACTCAAGCCTTCTGGAAGGCGGTCACAGCAGAGTTCCTGGCCATGC
TCATCTTTGTTCTGCTCAGCGTGGGATCCACCATTAACTGGGGTGGCTCAGAGAACCCCCTACCTGTGGA
CATGGTCCTCATCTCCCTCTGCTTTGGACTCAGCATTGCCACCATGGTTCAGTGCTTCGGCCACATCAGC
GGTGGCCACATCAACCCAGCGGTGACAGTGGCCATGGTGTGCACACGAAAGATCAGCATCGCCAAGTCCG
TCTTCTACATCACTGCGCAGTGCCTGGGGGCCATCATCGGAGCTGGGATCCTCTACCTGGTCACACCCCC
CAGCGTGGTGGGAGGATTGGGAGTCACCACGATCAATTATACCGGAGCCAGCATGAATCCAGCTCGATCC
TTTGGCCCTGCAGTTATCATGGGAAACTGGGAAAACCACTGGATATATTGGGTTGGACCAATCATAGGCG
CTGTGCTGGCAGGTGCACTTTACGAGTATGTCTTCTGTCCTGACGTGGAGCTCAAACGTCGCCTAAAGGA
AGCCTTCAGCAAAGCTGCACAGCAGACGAAAGGGAGCTACATGGAGGTGGAGGACAACCGGAGCCAAGTG
GAGACAGAAGACTTGATCCTGAAGCCCGGGGTGGTGCATGTGATCGACATTGACCGTGGAGACGAGAAGA
AGGGGAAGGACTCGTCTGGAGAGGTATTATCTTCTGTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270559
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270559.2, NP_001257488.1
RefSeq Size 4853 bp
RefSeq ORF 741 bp
Locus ID 25293
Cytogenetics 18p13
Gene Summary This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (4, also known as AQP4d) contains an alternate 5' terminal exon and lacks an in-frame coding exon compared to variant 1. These changes result in translation initiation from an in-frame, downstream start codon, and an isoform (4) with a shorter N-terminus and missing an internal protein segment compared to isoform M1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.