Igf2 (NM_001190163) Rat Untagged Clone
CAT#: RN215971
Igf2 (untagged) - Rat insulin-like growth factor 2 (Igf2), transcript variant 3
"NM_001190163" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Igf2 |
Synonyms | IGFII; RNIGF2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN215971 representing NM_001190163
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGATCCCAGTGGGGAAGTCGATGTTGGTGCTTCTCATCTCTTTGGCCTTCGCCTTGTGCTGCATCG CTGCTTACCGCCCCAGCGAGACTCTGTGCGGAGGGGAGCTTGTTGACACGCTTCAGTTTGTCTGTTCGGA CCGCGGCTTCTACTTCAGCAGGCCTTCAAGCCGTGCCAACCGTCGCAGCCGTGGCATCGTGGAAGAGTGC TGCTTCCGCAGCTGCGACTTGGCCCTCCTGGAGACATACTGTGCCACCCCCGCCAAGTCCGAGAGGGACG TGTCTACCTCTCAGGCCGTACTTCCGGACGACTTCCCCAGATACCCCGTGGGCAAGTTCTTCAAATTCGA CACCTGGAGACAGTCCGCGGGACGCCTGCGCAGAGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCGC ATGCTTGCCAAAGAGCTCGAAGCGTTCAGAGAGGCCAAGCGCCACCGTCCCCTGATCGTGTTACCACCCA AAGACCCCGCCCACGGGGGAGCCTCTTCGGAGATGTCCAGCAACCATCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001190163 |
Insert Size | 543 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001190163.1, NP_001177092.1 |
RefSeq Size | 3507 bp |
RefSeq ORF | 543 bp |
Locus ID | 24483 |
UniProt ID | P01346 |
Cytogenetics | 1q41 |
Gene Summary | a mitogenic growth factor; may have a role in fetal development [RGD, Feb 2006] Transcript Variant: This variant (3) uses an alternate exon at its 5' terminus and uses a downstream in-frame start codon, compared to variant 1. This results in a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR215971 | Igf2 (myc-DDK-tagged) - Rat insulin-like growth factor 2 (Igf2), transcript variant 3 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review