Rprm (NM_001044276) Rat Untagged Clone
CAT#: RN215055
Rprm (untagged ORF) - Rat reprimo, TP53 dependent G2 arrest mediator candidate (Rprm), (10 ug)
"NM_001044276" in other vectors (3)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Rprm |
Synonyms | MGC109515 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN215055 representing NM_001044276
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAATTCAGTGCTGGGCAACCAGACCGACGTGGCTGGCCTGTTCCTGGCCAACAGTAGCGAGGCGCTGG AGCGCGCGGTGCGCTGCTGCACCCAGGCGTCGGTGGTGACCGACGATGGCTTCGCCGAGGGCGGCCCCGA CGAGCGCAGCCTGTACATTATGCGCGTGGTGCAGATCGCTGTAATGTGTGTGCTCTCGCTCACCGTGGTT TTCGGCATCTTCTTCCTTGGCTGTAACCTGCTCATCAAGTCCGAAGGCATGATCAACTTCCTAGTGAAGG ACCGGAGGCCGTCTAAAGAGGTTGAGGCAGTGGTCGTGGGGCCCTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001044276 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001044276.1, NP_001037741.1 |
RefSeq Size | 1444 bp |
RefSeq ORF | 330 bp |
Locus ID | 680110 |
UniProt ID | Q5BJN9 |
Cytogenetics | 3q12 |
Gene Summary | May be involved in the regulation of p53-dependent G2 arrest of the cell cycle. Seems to induce cell cycle arrest by inhibiting CDK1 activity and nuclear translocation of the CDC2 cyclin B1 complex (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR215055 | Rprm (Myc-DDK-tagged ORF) - Rat reprimo, TP53 dependent G2 arrest mediator candidate (Rprm), (10 ug) |
USD 165.00 |
|
RR215055L3 | Lenti ORF clone of Rprm (Myc-DDK-tagged ORF) - Rat reprimo, TP53 dependent G2 arrest mediator candidate (Rprm), (10 ug) |
USD 465.00 |
|
RR215055L4 | Lenti ORF clone of Rprm (mGFP-tagged ORF) - Rat reprimo, TP53 dependent G2 arrest mediator candidate (Rprm), (10 ug) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review