Crip1 (NM_001134933) Rat Untagged Clone
CAT#: RN214609
Crip1 (untagged ORF) - Rat cysteine-rich intestinal protein (Crip), (10 ug)
"NM_001134933" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Crip1 |
Synonyms | Crip; Crp-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN214609 representing NM_001134933
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGAAGTGCCCCAAGTGCGACAAGGAGGTGTATTTCGCTGAGCGAGTGACGTCACTAGGCAAGGACT GGCATCGTCCCTGCCTGAAGTGCGAGAAATGTGGAAAGACACTGACCTCTGGGGGTCATGCTGAGCATGA AGGCAAGCCCTACTGCAACCATCCCTGCTACTCCGCCATGTTTGGGCCCAAAGGCTTTGGGCGAGGTGGA GCTGAAAGCCACACTTTCAAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001134933 |
Insert Size | 234 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001134933.2, NP_001128405.1 |
RefSeq Size | 480 bp |
RefSeq ORF | 234 bp |
Locus ID | 691657 |
UniProt ID | P63255 |
Cytogenetics | 6q32 |
Gene Summary | developmentally regulated LIM motif-containing zinc finger protein that may be involved in Th2 cytokine response [RGD, Feb 2006] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR214609 | Crip1 (Myc-DDK-tagged ORF) - Rat cysteine-rich intestinal protein (Crip), (10 ug) |
USD 165.00 |
|
RR214609L3 | Lenti ORF clone of Crip1 (Myc-DDK-tagged ORF) - Rat cysteine-rich intestinal protein (Crip), (10 ug) |
USD 465.00 |
|
RR214609L4 | Lenti ORF clone of Crip1 (mGFP-tagged ORF) - Rat cysteine-rich intestinal protein (Crip), (10 ug) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review