Acp2 (NM_016988) Rat Untagged Clone

CAT#: RN213595

Acp2 (untagged ORF) - Rat acid phosphatase 2, lysosomal (Acp2), (10 ug)


  "NM_016988" in other vectors (3)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Acp2 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Acp2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Acp2
Synonyms LAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213595 representing NM_016988
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGGCAGACAGTCTGGTTGGAGCCAGGCGGCTCTTCTCCAGTTCCTTCTTGGCATGTGCCTAATGG
TGATGCCACCCATACAAGCCCGGAGTCTGCGCTTTGTTACCTTGCTGTATCGACACGGAGATCGGTCACC
AGTGAAGGCATATCCTAAGGACCCCTATCAGGAAGAGAAATGGCCCCAGGGATTTGGTCAGCTAACCAAG
GAAGGGATGCTACAGCATTGGGAGCTGGGCCAGGCCCTGCGGCAACGCTACCATGGCTTTCTGAACGCCT
CTTACCACAGGCAAGAGGTTTACGTGCGAAGCACAGACTTTGACCGTACTCTCATGAGTGCAGAGGCCAA
CCTGGCCGGACTCTTCCCTCCCACTGAAGTTCAGCACTTCAACCCGAACATTTCATGGCAGCCTATCCCT
GTCCACACCGTGCCCATTACTGAAGACAGGTTGCTGAAGTTTCCTTTGGGTCCATGTCCCCGTTATGAGC
AGTTGCAGAACGAGACTCGGCAGACACCAGAGTATCAGAACATGAGTATTCAGAATGCACAATTTCTGGA
CATGGTGGCCAATGAGACAGGGCTTATGAACTTGACCCTAGAGACCATCTGGAATGTGTATGACACACTC
TTTTGTGAGCAAACACATGGGCTGCTCCTGCCACCCTGGGCCTCTCCCCAAACCGTGCAGCGTCTGAGCC
AGCTAAAGGACTTCAGCTTCCTCTTCCTCTTCGGGATCCACGATCAAGTACAGAAGGCCCGGCTTCAGGG
GGGAGTTCTGCTGGCTCAAATATTGAAGAATCTGACCCTAATGGCAACTACCTCTCAATTCCCTAAGCTT
CTGGTTTATTCTGCGCATGACACTACCCTGGTTGCTCTGCAAATGGCACTGAATGTCTACAATGGTAAAC
AAGCCCCCTATGCTTCCTGCCACATATTTGAACTGTACCAGGAAGATAATGGGAATTTCTCAGTCGAGAT
GTACTTTCGGAATGACAGTAAGAAGGCACCCTGGCCACTGACCCTGCCTGGCTGTCCTCACCGTTGCCCA
CTGCAGGACTTCCTTCGCCTCACAGAACCTGTCATACCCAAGGACTGGCAGAAGGAGTGCCAGCTAGCAA
GCGATACTGCAGACACAGAGGTGATTGTGGCACTGGCTGTCTGTGGCTCCATCCTCTTCCTTCTAATAGT
GTTGCTCCTCACTGTCCTCTTCCGGATGCAGGCCCAGCCTCCTGGCTACCACCATGTTGCAGACAGGGAA
GACCATGCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_016988
Insert Size 1272 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016988.2, NP_058684.2
RefSeq Size 2067 bp
RefSeq ORF 1272 bp
Locus ID 24162
Cytogenetics 3q24
Gene Summary The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Two isoforms are predicted to be produced from the same mRNA by the use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
Transcript Variant: This variant (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (1) results from translation termination at the upstream UGA stop codon, while the longer isoform (1x) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.