Fmc1 (NM_001037795) Rat Untagged Clone
CAT#: RN209822
Fmc1 (untagged ORF) - Rat formation of mitochondrial complexes 1 homolog (S. cerevisiae) (Fmc1), nuclear gene encoding mitochondrial protein, (10 ug)
"NM_001037795" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Symbol | Fmc1 |
Synonyms | MGC112899 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN209822 representing NM_001037795
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCCTTGGGGTCGCCGGCGCGCACTCTGCGAGGCCTTCTGCGGGAGCTGCGCTACCTGAACGCGG CCACCGGGCGACCATACCGCGACACAGCAGCCTACCGGTACCTGGTTAAGGCTTTCCGAGCACATCGGGT CACCAGTGAGAAGTTGTGCAGAGCCCAACACGAGCTTCACTTCCAAGCTGCCACCTATCTCTGCCTCTTG CGTAGTATCCGGCAACATGTAGCCCTTCATCAGGAATTTCATGGCAAGGGTGAGCGCTCAGTGGAGGAGT CTGCTGGTTTGGTGGGCCTCCAGTTGCCCCATCAGCCTGGAGGGAAGGGCTGGGAGCCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037795 |
Insert Size | 342 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037795.1, NP_001032884.1 |
RefSeq Size | 1367 bp |
RefSeq ORF | 342 bp |
Locus ID | 500087 |
UniProt ID | Q4G012 |
Cytogenetics | 4q22 |
Gene Summary | Plays a role in the assembly/stability of the mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR209822 | Fmc1 (Myc-DDK-tagged ORF) - Rat formation of mitochondrial complexes 1 homolog (S. cerevisiae) (Fmc1), nuclear gene encoding mitochondrial protein, (10 ug) |
USD 165.00 |
|
RR209822L3 | Lenti ORF clone of Fmc1 (Myc-DDK-tagged ORF) - Rat formation of mitochondrial complexes 1 homolog (S. cerevisiae) (Fmc1), nuclear gene encoding mitochondrial protein, (10 ug) |
USD 465.00 |
|
RR209822L4 | Lenti ORF clone of Fmc1 (mGFP-tagged ORF) - Rat formation of mitochondrial complexes 1 homolog (S. cerevisiae) (Fmc1), nuclear gene encoding mitochondrial protein, (10 ug) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review