Prrt1 (NM_001032285) Rat Untagged Clone

CAT#: RN204947

Prrt1 (untagged ORF) - Rat proline-rich transmembrane protein 1 (Prrt1), (10 ug)


  "NM_001032285" in other vectors (3)

Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Prrt1 Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Prrt1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Prrt1
Synonyms DSPD1; Ng5; Orf31
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN204947 representing NM_001032285
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGTCAGAAAAGTCAGGCCTTCCAGACTCGGTTCCCCACACTTCACCTCCGCCCTACAATGCCCCCC
AACCTCCAGCCGAGCCCCCCATCCCTCCCCCACAAACCGCTCCATCCTCTCATCATCATCACCACCACCA
CTACCACCAGTCTGGCACTGCCACCCTCCCGCGCTTAGGAGCAGGTGGCCTGGCCTCTGCTGCGGCTGGC
GCTCAACGTGGTCCTTCGTCCTCTGCCACGCTACCGCGGCCCCCCCACCATGCCCCTCCCGGTCCCGCTG
CTGGGGCTCCCCCACCCGGCTGTGCTACCCTACCCCGCATGCCACCCGACCCTTATCTGCAGGAGACTCG
CTTCGAGGGTCCACTTCCCCCACCACCGCCTGCGGCCGCCGCCCCACCCCCACCAGCGCCTGCCCCGACG
GCCCAAGCCCCAGGCTTCGTGGTGCCCACGCACGCGGGGGCGGTGGGCACGTTGCCGCTGGGGGGCTACG
TGGCTCCGGGCTACCCGCTGCAGCTGCAGCCGTGCACCGCTTATGTCCCGGTGTATCCGGTGGGCACGCC
CTACGCAAGCGGGACCCCCGGGGGTCCAGGAGTGACCTCCACTCTGCCCCCGCCGCCCCAGGGCCCAGGG
TTGGCTCTGTTGGAGCCCAGGCGCCCGCCGCATGACTACATGCCCATCGCTGTGCTGACCACCATCTGCT
GCTTCTGGCCCACAGGCATCATCGCCATCTTCAAGGCCGTGCAGGTGCGCACGGCCTTGGCCCGCGGAGA
CTTGGTGTCCGCCGAGATCGCTTCGCGCGAGGCCCGGAATTTCTCCTTCATCTCCCTGGCCGTGGGCATC
GCAGCTATGGTGCTTTGTACCATCCTCACTGTAGTCATCATCATTGCCGCCCAGCACCACGAAAACTACT
GGGATCCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001032285
Insert Size 921 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001032285.1, NP_001027456.1
RefSeq Size 1949 bp
RefSeq ORF 921 bp
Locus ID 406167
UniProt ID Q6MG82
Cytogenetics 20p12
Gene Summary Required to maintain a pool of extrasynaptic AMPA-regulated glutamate receptors (AMPAR) which is necessary for synapse development and function. Regulates basal AMPAR function and synaptic transmission during development but is dispensable at mature hippocampal synapses. Plays a role in regulating basal phosphorylation levels of glutamate receptor GRIA1 and promotes GRIA1 and GRIA2 cell surface expression.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.