Tbc1d7 (NM_001252640) Mouse Untagged Clone

CAT#: MC226607

Tbc1d7 (untagged) - Mouse TBC1 domain family, member 7 (Tbc1d7), transcript variant 3


  "NM_001252640" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tbc1d7"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tbc1d7
Synonyms 2610009C09Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226607 representing NM_001252640
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTGACGACTCTCAGAGGAACTTTCGATCAGTCTACTATGAGAAAGTCGGGTTTCGTGGTGTCGAAG
AAAAGAAATCACTGGAAATCCTCCTGAAAGATGACCGTTTGGACATCGAGAAGCTTTGCACATTTAGCCA
GAGGTTCCCTCTCCCATCCATGTATCGCGCGTTGGTATGGAAGGCGCTTCTAGGCATCTTACCTCCGCAC
CATGACACTCATTCCCAGGTGATGGCCTACCGCAAAGACCAGTACCATGACATCCTCCATGCCCTGACAG
TCGTCCGCTTCATCAGTGATGCCACGCCACAGGCTGAAGTGTATCTTCGCATGTATCAGCTTGAATCGGG
GAAGCTACCTCGAAGTCCCTCTTTTCCTCTGGAGCCGGAGGATGAAGTCTTTCTTGCCATCGCCAAGGCC
ATGGAAGAGATGGTGGAAGACAGTGTGGACTGTTACTGGATCAGCCGATGCTTCGTGAAGCAGTTAAATA
ACAAGTACAGGGACGCTTTACCTCAGCTGCCCAAGGCTTTCGAGCAGTACTTGAATCTGGAAGACAGTAG
GCTGCTGAGTCACCTGAAGACGTGTTCTGCAGTGTCCAAACTGCCTTACGACCTCTGGTTCCAAAGGTGC
TTCGCGGGATGCCTCCCCGAGTCCAGTTTACAGAGGGTCTGGGATAAAGTCATTCCTCAGGACAGCTCAG
ATGCCATCGTGAGCAAGGCCATCGACTTGTGGCACAAACACTGTGGGACCCCAGTGCATTCGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001252640
Insert Size 768 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252640.1, NP_001239569.1
RefSeq Size 1154 bp
RefSeq ORF 768 bp
Locus ID 67046
UniProt ID Q9D0K0
Cytogenetics 13 A4
Gene Summary Component of the TSC-TBC complex, that contains TBC1D7 in addition to the TSC1-TSC2 complex and consists of the functional complex possessing GTPase-activating protein (GAP) activity toward RHEB in response to alterations in specific cellular growth conditions. The small GTPase RHEB is a direct activator of the protein kinase activity of mTORC1 and the TSC-TBC complex acts as a negative regulator of mTORC1 signaling cascade by acting as a GAP for RHEB. Participates in the proper sensing of growth factors and glucose, but not amino acids, by mTORC1. It is unclear whether TBC1D7 acts as a GTPase-activating protein and additional studies are required to answer this question.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has an alternate splice site in the 3' coding region, compared to variant 1. The reading frame is not affected and the resulting isoform (3) lacks an internal segment, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.