G6pc2 (NM_001289856) Mouse Untagged Clone
CAT#: MC226500
G6pc2 (untagged) - Mouse glucose-6-phosphatase, catalytic, 2 (G6pc2), transcript variant 2
"NM_001289856" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | G6pc2 |
Synonyms | G6pc; G6pc-rs; I; IGRP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226500 representing NM_001289856
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCTCATCGTGCGTCTGGTATGTCATGGTAACAGCTGCCCTAAGCTACACCATCAGCCGGATGGAGG AGTCCTCTGTCACTCTGCACAGACTGACCTGGTCCTTTCTGTGGAGTGTTTTCTGGTTGATTCAAATCAG CGTCTGCATCTCAAGAGTATTCATAGCCACACATTTCCCCCATCAGGTCATTCTTGGAGTGATTGGTGGG ATGCTAGTAGCCGAGGCCTTTGAACACACTCCAGGAGTCCACATGGCCAGCTTGAGTGTGTACCTGAAGA CCAACGTCTTCCTCTTCCTGTTTGCCCTCGGCTTTTACCTGCTTCTCCGACTGTTCGGTATTGACCTGCT GTGGTCCGTGCCCATCGCCAAAAAGTGGTGTGCCAACCCAGACTGGATCCACATTGACAGCACGCCTTTT GCTGGACTCGTGAGAAACCTCGGGGTCCTCTTTGGCTTGGGTTTCGCCATCAACTCAGAAATGTTCCTTC GGAGCTGCCAGGGAGAAAATGGCACCAAGCCGAGCTTCCGCTTGCTCTGTGCTCTGACCTCACTGACCAC AATGCAACTTTATCGCTTCATCAAGATCCCGACTCACGCGGAACCTTTATTTTACCTGTTGTCTTTCTGT AAAAGTGCGTCCATCCCCCTGATGGTGGTGGCTCTAATTCCCTACTGTGTACATATGTTAATGAGACCCG GTGACAAGAAGACTAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289856 |
Insert Size | 720 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289856.1, NP_001276785.1 |
RefSeq Size | 1846 bp |
RefSeq ORF | 720 bp |
Locus ID | 14378 |
UniProt ID | Q9Z186 |
Cytogenetics | 2 39.66 cM |
Gene Summary | This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (2) contains an alternate 5' terminal exon, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228711 | G6pc2 (myc-DDK-tagged) - Mouse glucose-6-phosphatase, catalytic, 2 (G6pc2), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review