Meaf6 (NM_001290701) Mouse Untagged Clone

CAT#: MC226187

Meaf6 (untagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6), transcript variant 2


  "NM_001290701" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Meaf6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Meaf6
Synonyms 2310005N01Rik; 2810036M01Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226187 representing NM_001290701
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGATGCACAACAAGACGGCGCCGCCGCAGATCCCAGACACCCGGCGGGAGCTGGCCGAGCTGGTTA
AGCGGAAGCAGGAGCTGGCGGAAACACTTGCAAACTTGGAGAGACAGATATATGCTTTTGAAGGAAGCTA
CCTGGAAGACACTCAGATGTATGGCAATATTATCCGTGGCTGGGATCGGTATTTGACCAATCAAAAGAAC
TCCAATAGCAAAAACGACCGGAGGAACCGGAAGTTCAAGGAGGCCGAACGGCTCTTCAGCAAATCCTCAG
TCACGTCGGCTGCTGCAGTAAGTGCCTTGGCAGGGGTTCAGGACCAGCTCATCGAAAAGAGGGAACCAGG
AAGTGGGACGGAAAGCGATACTTCTCCAGACTTCCACAATCAGGAAAACGAGCCTGCGCAGGAGGACCCC
GAGGACCTAGACGGCTCCGTCCAGGGAGTGAAACCTCAGAAAGCCGCCTCTTCCACCTCCTCAGGAAGCC
ACCACAGCAGCCACAAAAAACGGAAGAATAAAAACCGGCACAGGATTGATCTGAAGTTAAACAAAAAGCC
CCGAGCTGACTATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290701
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290701.1, NP_001277630.1
RefSeq Size 1382 bp
RefSeq ORF 576 bp
Locus ID 70088
UniProt ID Q2VPQ9
Cytogenetics 4 D2.2
Gene Summary Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. Component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Component of the MOZ/MORF complex which has a histone H3 acetyltransferase activity (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate exon in 3' coding region and uses an alternate splice site in the 3' terminal exon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.