Cenpa (NM_001302131) Mouse Untagged Clone
CAT#: MC225676
Cenpa (untagged) - Mouse centromere protein A (Cenpa), transcript variant 4
"NM_001302131" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cenpa |
Synonyms | Cen; Cenp-A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225676 representing NM_001302131
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGGCTCTCAGACACTGCGCAGAAGACAGAAATTCATGTGGCTTAAGGAAATCAAGACCCTGCAGA AGAGCACAGACCTCTTGTTCAGGAAGAAGCCTTTCAGCATGGTTGTTAGAGAAATATGTGAGAAGTTCAG CCGTGGTGTGGATTTTTGGTGGCAAGCCCAGGCCTTGTTGGCCCTTCAGGAGGCAGCAGAAGCTTTCCTC ATCCACCTCTTTGAGGACGCCTACCTCCTCTCCTTACATGCTGGTCGGGTCACGCTTTTCCCCAAAGACA TTCAGTTGACCAGGAGAATCCGAGGCTTCGAGGGCGGACTCCCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302131 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302131.1, NP_001289060.1 |
RefSeq Size | 1555 bp |
RefSeq ORF | 327 bp |
Locus ID | 12615 |
UniProt ID | O35216 |
Cytogenetics | 5 16.76 cM |
Gene Summary | Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. This gene encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. Centromere protein A is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. The protein is a replication-independent histone that is a member of the histone H3 family. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (4) contains two alternate exons in the 5' coding region and uses a downstream start codon compared to variant 1. The resulting isoform (2) has a distinct shorter N-terminus, compared to isoform 1. Variants 2, 3 and 4 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227887 | Cenpa (myc-DDK-tagged) - Mouse centromere protein A (Cenpa), transcript variant 4 |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review