Dnajb6 (NM_011847) Mouse Untagged Clone

CAT#: MC218081

Dnajb6 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily B, member 6 (Dnajb6), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dnajb6
• Synonyms: HSJ-2; mDj4; Mrj
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC218081 representing NM_011847
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTGGATTACTATGAAGTGCTGGGCGTGCAGAGACATGCCTCACCTGAGGACATTAAAAAGGCGTATC
  GAAAACAGGCACTTAAATGGCACCCGGACAAAAATCCTGAAAATAAAGAAGAAGCAGAGCGGAAGTTCAA
  ACAAGTAGCTGAGGCATATGAAGTGTTATCGGATGCTAAAAAGCGGGACATCTACGACAAATATGGCAAA
  GAAGGATTAAATGGTGGTGGAGGAGGAGGTGGAATTCATTTTGACAGTCCATTTGAGTTTGGCTTCACAT
  TCCGGAACCCAGATGATGTCTTCAGGGAATTTTTTGGTGGAAGGGACCCATTTTCATTTGACTTCTTTGA
  AGACCCATTTGATGACTTTTTTGGAAACCGAAGGGGTCCCCGAGGAAATAGAAGCCGAGGTGCCGGCTCA
  TTTTTCTCTACCTTCAGTGGATTTCCTTCTTTTGGAAGTGGATTTCCTGCTTTTGATACAGGCTTCACTC
  CATTTGGGTCACTAGGTCATGGGGGTCTCACTTCATTTTCTTCAACGTCATTTGGCGGCAGTGGAATGGG
  CAACTTCAAATCAATATCAACTTCAACTAAGATAGTTAATGGCAAAAAAATCACGACAAAGAGGATTGTG
  GAGAACGGTCAAGAAAGAGTAGAAGTTGAAGAAGATGGGCAGTTAAAGTCCTTGACAATAAATGGTAAGG
  AGCACCTGCTACGCTTGGATAACAAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011847
• Insert Size: 729 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_011847.4, NP_035977.2
• RefSeq Size: 1645 bp
• RefSeq ORF: 729 bp
• Locus ID: 23950
• UniProt ID: O54946
• Cytogenetics: 5 B1
• Gene Summary: Plays an indispensable role in the organization of KRT8/KRT18 filaments. Acts as an endogenous molecular chaperone for neuronal proteins including huntingtin. Suppresses aggregation and toxicity of polyglutamine-containing, aggregation-prone proteins (By similarity). Has a stimulatory effect on the ATPase activity of HSP70 in a dose-dependent and time-dependent manner and hence acts as a co-chaperone of HSP70. Also reduces cellular toxicity and caspase-3 activity (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR when compared to variant 1. Variant 3 encodes isoform c, which has a shorter, distinct C-terminus when compared to isoform a.