Ube2q1 (BC082275) Mouse Untagged Clone

CAT#: MC217869

Ube2q1 (untagged) - Mouse ubiquitin-conjugating enzyme E2Q (putative) 1 (cDNA clone MGC:90946 IMAGE:6310111), (10ug)


  "BC082275" in other vectors (4)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ube2q1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ube2q1
Synonyms NICE-5, PRO3094, Ube2q
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC082275
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGGATCAGCCCTTGCCAGCAGAGCAGTGCACGCAGGAAGAAGTGTCTTCAGAAGATGAAGATGAAG
AGATGCCTGAGGATACAGAAGACCTAGATCACTATGAAATGAAAGAGGAAGAGCCAGCCGAGGGCAAGAA
GTCTGAAGATGATGGCATCGGAAAAGAGAACCTGGCCATCCTAGAGAAAATTAAAAAGAACCAGAGGCAA
GATTACTTAAATGGTGCAGTGTCTGGCTCGGTGCAGGCCACTGACCGGCTGATGAAGGAGCTCAGGGATA
TATACCGATCACAGAGTTTCAAAGGCGGAAACTATGCAGTCGAACTCGTGAATGACAGTCTCTATGACTG
GAATGTCAAACTCCTCAAAGTTGACCAGGATAGCGCTTTGCACAATGATCTTCAGATCCTGAAGGAGAAG
GAAGGAGCAGACTTCATCCTACTTAACTTCTCCTTTAAAGATAACTTCCCCTTTGACCCACCGTTCGTCA
GGGTTGTGTCTCCAGTCCTCTCTGGAGGGTATGTTCTGGGTGGAGGTGCCATCTGCATGGAACTTCTCAC
CAAGCAGGGCTGGAGCAGTGCCTACTCCATAGAGTCCGTGATCATGCAGATCAGCGCCACGCTGGTGAAG
GGGAAAGCACGGGTGCAGTTTGGAGCCAACAAATCTCAGTATAGCCTGACGAGAGCACAGCAGTCCTACA
AGTCCTTGGTGCAGATCCATGAAAAAAACGGCTGGTACACACCCCCAAAGGAAGATGGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC082275
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC082275, AAH82275
RefSeq Size 1686 bp
RefSeq ORF 761 bp
Locus ID 70093
Cytogenetics 3 F1
Gene Summary Catalyzes the covalent attachment of ubiquitin to other proteins (By similarity). Involved in female fertility and embryo implantation (PubMed:23108111). May be involved in hormonal homeostasis in females (PubMed:23108111). Involved in regulation of B4GALT1 cell surface expression, B4GALT1-mediated cell adhesion to laminin and embryoid body formation (PubMed:18511602).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.